Incidental Mutation 'R7467:Crat'
ID578830
Institutional Source Beutler Lab
Gene Symbol Crat
Ensembl Gene ENSMUSG00000026853
Gene Namecarnitine acetyltransferase
SynonymsCARAT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30400471-30415813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30409982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 129 (F129V)
Ref Sequence ENSEMBL: ENSMUSP00000028207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000102854] [ENSMUST00000102855] [ENSMUST00000129494] [ENSMUST00000132981] [ENSMUST00000134120] [ENSMUST00000142096] [ENSMUST00000156702]
PDB Structure
Crystal structure of Carnitine Acetyltransferase [X-RAY DIFFRACTION]
Carnitine Acetyltransferase in Complex with Carnitine [X-RAY DIFFRACTION]
Carnitine Acetyltransferase in complex with CoA [X-RAY DIFFRACTION]
Crystal structure of the M564G mutant of murine CrAT [X-RAY DIFFRACTION]
Crystal structure of the M564G mutant of murine carnitine acetyltransferase in complex with carnitine [X-RAY DIFFRACTION]
Crystal structure of the F565A mutant of murine carnitine acetyltransferase in complex with carnitine and CoA [X-RAY DIFFRACTION]
Crystal structure of murine carnitine acetyltransferase in complex with carnitine and acetyl-CoA [X-RAY DIFFRACTION]
Crystal structure of murine carnitine acetyltransferase in complex with carnitine and CoA [X-RAY DIFFRACTION]
Crystal structure of the S554A/M564G mutant of murine carnitine acetyltransferase in complex with hexanoylcarnitine and CoA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028207
AA Change: F129V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853
AA Change: F129V

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102854
AA Change: F108V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099918
Gene: ENSMUSG00000026853
AA Change: F108V

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 13 595 1.8e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102855
AA Change: F129V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853
AA Change: F129V

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129494
Predicted Effect probably damaging
Transcript: ENSMUST00000132981
AA Change: F129V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118507
Gene: ENSMUSG00000026853
AA Change: F129V

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 76 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134120
Predicted Effect probably benign
Transcript: ENSMUST00000142096
Predicted Effect probably benign
Transcript: ENSMUST00000155790
SMART Domains Protein: ENSMUSP00000122814
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 133 2.4e-51 PFAM
Pfam:Carn_acyltransf 128 190 8.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156702
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes carnitine O-acetyltransferase, a member of the carnitine acyltransferase family and a key metabolic pathway enzyme which plays an important role in energy homeostasis and fat metabolism. This enzyme catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acyl-CoA/CoA. It is found in both the mitochondria and the peroxisome. Alternative splicing results in transcript variants encoding different isoforms that may localize to different subcellular compartments. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice with muscle specific loss of function display increased circulating glucose level, impaired glucose tolerance, insulin resistance, decreased circulating triglyceride and free fatty acid levels, increased susceptibility to diet-induced obesity and abnormal mitochondrial physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 A G 7: 45,145,907 Y443H probably benign Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
Atxn2 T C 5: 121,802,267 probably null Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Kifap3 A T 1: 163,815,833 H209L probably benign Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp1r13l A T 7: 19,371,380 Q359L probably damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Sirt1 T C 10: 63,322,150 N495S probably benign Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap1 C A 10: 121,855,439 E297* probably null Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Crat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Crat APN 2 30405187 missense probably damaging 0.99
IGL01357:Crat APN 2 30407724 missense probably damaging 1.00
IGL01538:Crat APN 2 30409966 missense probably damaging 1.00
IGL01973:Crat APN 2 30405481 missense probably damaging 0.98
IGL02228:Crat APN 2 30413182 missense probably damaging 1.00
IGL02408:Crat APN 2 30407134 missense probably damaging 1.00
IGL02569:Crat APN 2 30404530 missense probably damaging 0.99
IGL02637:Crat APN 2 30406389 missense probably benign 0.06
IGL02983:Crat APN 2 30404526 critical splice donor site probably null
IGL03395:Crat APN 2 30404966 missense probably benign 0.11
Charlie UTSW 2 30403541 missense probably damaging 1.00
veruca UTSW 2 30403628 unclassified probably benign
R0136:Crat UTSW 2 30407030 missense probably benign
R0389:Crat UTSW 2 30403628 unclassified probably benign
R0443:Crat UTSW 2 30403628 unclassified probably benign
R0619:Crat UTSW 2 30409984 missense probably benign 0.14
R1938:Crat UTSW 2 30413061 missense probably benign
R1990:Crat UTSW 2 30405048 missense possibly damaging 0.93
R2113:Crat UTSW 2 30402642 missense probably benign 0.00
R2655:Crat UTSW 2 30402691 missense probably damaging 1.00
R3150:Crat UTSW 2 30413859 critical splice donor site probably null
R4231:Crat UTSW 2 30413011 missense possibly damaging 0.95
R4553:Crat UTSW 2 30408217 missense probably benign 0.00
R4592:Crat UTSW 2 30415366 utr 5 prime probably benign
R4718:Crat UTSW 2 30408164 nonsense probably null
R4808:Crat UTSW 2 30410021 missense probably benign 0.01
R4982:Crat UTSW 2 30407136 critical splice acceptor site probably null
R5473:Crat UTSW 2 30407714 missense probably damaging 1.00
R6049:Crat UTSW 2 30403541 missense probably damaging 1.00
R6223:Crat UTSW 2 30407030 missense probably benign 0.07
R6774:Crat UTSW 2 30413183 missense probably damaging 1.00
R6885:Crat UTSW 2 30415196 splice site probably benign
R7376:Crat UTSW 2 30406465 missense probably damaging 1.00
R7407:Crat UTSW 2 30404565 missense probably benign 0.01
R7408:Crat UTSW 2 30404565 missense probably benign 0.01
R7410:Crat UTSW 2 30404565 missense probably benign 0.01
R7484:Crat UTSW 2 30404565 missense probably benign 0.01
R7514:Crat UTSW 2 30404565 missense probably benign 0.01
R7582:Crat UTSW 2 30404565 missense probably benign 0.01
R7584:Crat UTSW 2 30404565 missense probably benign 0.01
R7585:Crat UTSW 2 30404565 missense probably benign 0.01
R7620:Crat UTSW 2 30408078 missense probably damaging 0.99
R7685:Crat UTSW 2 30404565 missense probably benign 0.01
R7686:Crat UTSW 2 30404565 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATGAGAAGCCTGTCCTCTTG -3'
(R):5'- ACTTGCTGGGAGATAGTCCTGC -3'

Sequencing Primer
(F):5'- ATGAGAAGCCTGTCCTCTTGACTTG -3'
(R):5'- GAGATAGTCCTGCAGAGACCC -3'
Posted On2019-10-07