Incidental Mutation 'R7467:Atxn2'
ID578850
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Nameataxin 2
Synonyms9630045M23Rik, ATX2, Sca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121711337-121816493 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121802267 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327]
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 A G 7: 45,145,907 Y443H probably benign Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Crat A C 2: 30,409,982 F129V probably damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Kifap3 A T 1: 163,815,833 H209L probably benign Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp1r13l A T 7: 19,371,380 Q359L probably damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Sirt1 T C 10: 63,322,150 N495S probably benign Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap1 C A 10: 121,855,439 E297* probably null Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121795055 missense probably benign 0.00
IGL00798:Atxn2 APN 5 121795235 missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121810979 missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121797344 missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121806268 nonsense probably null
IGL02122:Atxn2 APN 5 121778030 missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121781387 missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121781336 missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121810909 missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121785235 missense probably benign 0.00
R0387:Atxn2 UTSW 5 121802143 missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121772778 missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121747421 unclassified probably null
R1305:Atxn2 UTSW 5 121749184 missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121803082 critical splice donor site probably null
R1471:Atxn2 UTSW 5 121786374 missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121779591 missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121802108 missense probably damaging 0.99
R1528:Atxn2 UTSW 5 121813530 missense probably damaging 1.00
R2083:Atxn2 UTSW 5 121784006 missense probably benign 0.00
R2197:Atxn2 UTSW 5 121806217 splice site probably null
R2217:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121781393 missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121785868 critical splice donor site probably null
R4604:Atxn2 UTSW 5 121781343 missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121814411 missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121749096 missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121814343 missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121795035 unclassified probably null
R5213:Atxn2 UTSW 5 121814480 unclassified probably null
R5655:Atxn2 UTSW 5 121747426 missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121813449 missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121797310 missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121810992 missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121779432 missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121811614 critical splice donor site probably null
R6659:Atxn2 UTSW 5 121777964 missense probably benign 0.10
R6864:Atxn2 UTSW 5 121779494 missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121811467 nonsense probably null
R7166:Atxn2 UTSW 5 121796397 missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121778021 missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121785817 missense possibly damaging 0.62
R7544:Atxn2 UTSW 5 121781368 missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121796377 missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121802117 missense possibly damaging 0.79
R7966:Atxn2 UTSW 5 121802117 missense possibly damaging 0.79
X0028:Atxn2 UTSW 5 121802083 missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121777990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTGCATGAATTATACCGAC -3'
(R):5'- GCATACGGTTTACAACACGC -3'

Sequencing Primer
(F):5'- TTCGTGCAGTACCAAATATGCC -3'
(R):5'- GGTTTACAACACGCAAAACTAAG -3'
Posted On2019-10-07