Incidental Mutation 'R7467:Atxn2'
ID 578850
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 045541-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R7467 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121940330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161159
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,098,952 (GRCm39) V153I probably benign Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Aldh16a1 A G 7: 44,795,331 (GRCm39) Y443H probably benign Het
Apbb1 A G 7: 105,215,339 (GRCm39) V434A probably benign Het
Atrip A G 9: 108,898,422 (GRCm39) M199T probably damaging Het
AU040320 A G 4: 126,708,103 (GRCm39) T240A probably benign Het
Btf3l4 A T 4: 108,675,589 (GRCm39) probably null Het
Ccdc106 A G 7: 5,063,325 (GRCm39) T277A probably damaging Het
Cdk15 G T 1: 59,328,938 (GRCm39) W282L probably null Het
Cflar T A 1: 58,765,597 (GRCm39) M1K probably null Het
Champ1 C A 8: 13,928,579 (GRCm39) P246T possibly damaging Het
Crat A C 2: 30,299,994 (GRCm39) F129V probably damaging Het
Csmd3 T C 15: 47,492,640 (GRCm39) N2256S Het
Cwh43 C A 5: 73,569,311 (GRCm39) Q118K probably damaging Het
Daam1 A T 12: 72,032,580 (GRCm39) K949* probably null Het
Ddn C G 15: 98,703,247 (GRCm39) E682Q possibly damaging Het
Des T A 1: 75,339,605 (GRCm39) M321K possibly damaging Het
Dnm2 T C 9: 21,392,672 (GRCm39) V460A probably damaging Het
Dst G A 1: 34,230,236 (GRCm39) E2610K probably benign Het
Efr3a C T 15: 65,729,360 (GRCm39) T660I possibly damaging Het
Eogt T C 6: 97,119,794 (GRCm39) E138G probably benign Het
Epha8 G A 4: 136,658,399 (GRCm39) A992V possibly damaging Het
Exoc2 A T 13: 31,109,716 (GRCm39) D217E probably damaging Het
Fam222b T C 11: 78,045,173 (GRCm39) S245P probably damaging Het
Fbxo45 T C 16: 32,057,339 (GRCm39) Y185C probably damaging Het
Fbxo47 T C 11: 97,755,993 (GRCm39) T170A probably benign Het
Fbxw26 A T 9: 109,561,765 (GRCm39) V143E probably benign Het
Foxb2 T C 19: 16,851,004 (GRCm39) M1V probably null Het
Gm11596 C A 11: 99,683,962 (GRCm39) V53L unknown Het
Gm47791 A G 1: 82,748,547 (GRCm39) *140Q probably null Het
Gpr179 C T 11: 97,226,115 (GRCm39) M2013I probably benign Het
Hck T A 2: 152,971,850 (GRCm39) L137* probably null Het
Hectd4 T A 5: 121,462,024 (GRCm39) C964S possibly damaging Het
Hexa T C 9: 59,464,683 (GRCm39) probably null Het
Ifna12 C A 4: 88,521,502 (GRCm39) S15I possibly damaging Het
Kif18b C A 11: 102,807,234 (GRCm39) V34L probably damaging Het
Kif18b A T 11: 102,803,174 (GRCm39) probably null Het
Kifap3 A T 1: 163,643,402 (GRCm39) H209L probably benign Het
Klhl1 A T 14: 96,360,713 (GRCm39) D712E probably damaging Het
Kmt2c T C 5: 25,513,530 (GRCm39) D3088G probably damaging Het
Mageb3 A G 2: 121,784,953 (GRCm39) Y250H probably damaging Het
Manba G T 3: 135,250,562 (GRCm39) E396D probably damaging Het
Mapkbp1 T A 2: 119,852,669 (GRCm39) V997E probably damaging Het
Mdc1 A G 17: 36,155,448 (GRCm39) H41R probably benign Het
Mis18a T G 16: 90,516,866 (GRCm39) M179L probably benign Het
Mmp25 C G 17: 23,863,756 (GRCm39) G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 (GRCm39) D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 (GRCm39) P286S probably benign Het
Mrgpra2b G A 7: 47,114,277 (GRCm39) H152Y possibly damaging Het
Mslnl A T 17: 25,955,895 (GRCm39) M1L probably benign Het
Myo1d G A 11: 80,477,743 (GRCm39) T880I probably damaging Het
Ncaph T A 2: 126,975,795 (GRCm39) probably benign Het
Nln T C 13: 104,161,530 (GRCm39) D680G possibly damaging Het
Noct C T 3: 51,132,622 (GRCm39) A33V probably benign Het
Nolc1 A G 19: 46,070,773 (GRCm39) T325A unknown Het
Nr2e3 A G 9: 59,856,434 (GRCm39) probably null Het
Nrg2 T A 18: 36,155,459 (GRCm39) H450L probably benign Het
Or13a21 T C 7: 139,999,287 (GRCm39) N133S probably benign Het
Or2t43 A C 11: 58,457,288 (GRCm39) N294K possibly damaging Het
Or5ak24 T G 2: 85,261,171 (GRCm39) M1L possibly damaging Het
Or5an1 T A 19: 12,260,839 (GRCm39) C142* probably null Het
Or6b3 T A 1: 92,439,570 (GRCm39) Y60F possibly damaging Het
Pank2 T A 2: 131,115,967 (GRCm39) N128K possibly damaging Het
Pcdha3 T C 18: 37,080,584 (GRCm39) V442A probably damaging Het
Pds5b T A 5: 150,659,792 (GRCm39) S252T probably damaging Het
Pfpl T C 19: 12,405,878 (GRCm39) L43S probably damaging Het
Pigu T A 2: 155,141,009 (GRCm39) I295F probably damaging Het
Piwil4 T C 9: 14,616,337 (GRCm39) Y673C probably damaging Het
Pls1 A G 9: 95,651,166 (GRCm39) Y414H possibly damaging Het
Ppp1r13l A T 7: 19,105,305 (GRCm39) Q359L probably damaging Het
Ppp2r5c A G 12: 110,519,317 (GRCm39) Y263C probably damaging Het
Prrc2c A T 1: 162,504,932 (GRCm39) S2638R possibly damaging Het
Prss39 T A 1: 34,538,473 (GRCm39) probably null Het
Psmd1 G A 1: 86,044,355 (GRCm39) V648M probably damaging Het
Rad50 T C 11: 53,545,735 (GRCm39) D1196G probably damaging Het
Rfx1 T C 8: 84,800,542 (GRCm39) Y48H possibly damaging Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rpl9 T C 5: 65,548,310 (GRCm39) T9A probably benign Het
Samd4 A G 14: 47,325,313 (GRCm39) N598D probably benign Het
Sema7a T C 9: 57,868,705 (GRCm39) Y606H probably damaging Het
Sf3b3 A G 8: 111,538,088 (GRCm39) S1150P possibly damaging Het
Sirt1 T C 10: 63,157,929 (GRCm39) N495S probably benign Het
Slc17a3 T C 13: 24,030,950 (GRCm39) probably null Het
Slc25a22 T C 7: 141,013,889 (GRCm39) T24A probably benign Het
Slc30a9 T C 5: 67,502,987 (GRCm39) I363T probably benign Het
Srbd1 A G 17: 86,406,702 (GRCm39) V561A probably damaging Het
Srgap1 C A 10: 121,691,344 (GRCm39) E297* probably null Het
Srgap2 T C 1: 131,220,405 (GRCm39) S896G probably damaging Het
Sspo T C 6: 48,463,237 (GRCm39) C3730R probably damaging Het
Stat2 T A 10: 128,113,772 (GRCm39) probably null Het
Tcof1 T C 18: 60,964,977 (GRCm39) K581E unknown Het
Tdpoz6 T A 3: 93,600,265 (GRCm39) T35S probably benign Het
Thbs1 T C 2: 117,948,681 (GRCm39) S446P probably damaging Het
Thsd7a T C 6: 12,331,584 (GRCm39) Y1330C Het
Tmem121 C A 12: 113,152,690 (GRCm39) P303T probably benign Het
Tmem87b T A 2: 128,691,071 (GRCm39) probably null Het
Tmem98 A T 11: 80,711,011 (GRCm39) probably null Het
Trpm3 T A 19: 22,955,698 (GRCm39) I1091N possibly damaging Het
Urb2 A G 8: 124,755,250 (GRCm39) E319G probably benign Het
Vmn1r170 A T 7: 23,306,320 (GRCm39) M241L not run Het
Vmn1r238 T C 18: 3,123,393 (GRCm39) N7S probably benign Het
Wdr6 T C 9: 108,450,201 (GRCm39) H1109R probably benign Het
Zdhhc13 T C 7: 48,454,156 (GRCm39) V193A probably benign Het
Zfp354c T C 11: 50,706,253 (GRCm39) Y274C probably damaging Het
Zfp738 T A 13: 67,821,080 (GRCm39) E89V probably benign Het
Zswim3 T A 2: 164,661,795 (GRCm39) F92I possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTGCATGAATTATACCGAC -3'
(R):5'- GCATACGGTTTACAACACGC -3'

Sequencing Primer
(F):5'- TTCGTGCAGTACCAAATATGCC -3'
(R):5'- GGTTTACAACACGCAAAACTAAG -3'
Posted On 2019-10-07