Incidental Mutation 'R7467:Ppp1r13l'
ID578856
Institutional Source Beutler Lab
Gene Symbol Ppp1r13l
Ensembl Gene ENSMUSG00000040734
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13 like
SynonymsNFkB interacting protein 1, wa3, IASPP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19359749-19378533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19371380 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 359 (Q359L)
Ref Sequence ENSEMBL: ENSMUSP00000047839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047621] [ENSMUST00000127785] [ENSMUST00000132655] [ENSMUST00000140836]
Predicted Effect probably damaging
Transcript: ENSMUST00000047621
AA Change: Q359L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734
AA Change: Q359L

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127785
SMART Domains Protein: ENSMUSP00000116351
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132655
SMART Domains Protein: ENSMUSP00000118309
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140836
SMART Domains Protein: ENSMUSP00000114443
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for spontaneous mutations in this gene exhibit cardiovascular defects leading to cardiomyopathy, open eyelids at birth, and coat abnormalities. One allele also shows postnatal lethality dependent on strain background and decreased weight, while another shows impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 A G 7: 45,145,907 Y443H probably benign Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
Atxn2 T C 5: 121,802,267 probably null Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Crat A C 2: 30,409,982 F129V probably damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Kifap3 A T 1: 163,815,833 H209L probably benign Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Sirt1 T C 10: 63,322,150 N495S probably benign Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap1 C A 10: 121,855,439 E297* probably null Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Ppp1r13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ppp1r13l APN 7 19375268 missense probably damaging 1.00
IGL01800:Ppp1r13l APN 7 19378011 unclassified probably benign
IGL02714:Ppp1r13l APN 7 19377643 missense possibly damaging 0.93
IGL03251:Ppp1r13l APN 7 19368869 splice site probably benign
R0507:Ppp1r13l UTSW 7 19375814 missense possibly damaging 0.63
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1845:Ppp1r13l UTSW 7 19368611 missense probably damaging 0.97
R1885:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R1886:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R2118:Ppp1r13l UTSW 7 19371421 missense possibly damaging 0.89
R4063:Ppp1r13l UTSW 7 19370053 missense probably benign
R4685:Ppp1r13l UTSW 7 19375383 critical splice donor site probably null
R5121:Ppp1r13l UTSW 7 19370095 missense probably damaging 1.00
R5604:Ppp1r13l UTSW 7 19375599 missense possibly damaging 0.89
R5669:Ppp1r13l UTSW 7 19373022 missense probably benign 0.00
R5911:Ppp1r13l UTSW 7 19375892 critical splice donor site probably null
R6002:Ppp1r13l UTSW 7 19377970 missense probably benign 0.22
R6058:Ppp1r13l UTSW 7 19370575 missense probably benign 0.01
R6170:Ppp1r13l UTSW 7 19370437 missense probably benign 0.13
R6171:Ppp1r13l UTSW 7 19377511 missense probably benign 0.06
R6246:Ppp1r13l UTSW 7 19369858 missense probably benign 0.00
R6418:Ppp1r13l UTSW 7 19371331 missense probably damaging 1.00
R6845:Ppp1r13l UTSW 7 19371398 missense probably damaging 0.99
R7367:Ppp1r13l UTSW 7 19370156 missense probably benign 0.36
R7381:Ppp1r13l UTSW 7 19368861 critical splice donor site probably null
R7510:Ppp1r13l UTSW 7 19368801 missense possibly damaging 0.52
RF015:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
RF022:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CTCACCAGCGCCACTCTG -3'
(R):5'- GACTCACCTTCATTCATGGGAGA -3'

Sequencing Primer
(F):5'- TCTGCCACGCAATTACAAGGTG -3'
(R):5'- AGACCAAGTCTGTTGAGGTGC -3'
Posted On2019-10-07