Incidental Mutation 'R7467:Aldh16a1'
ID578858
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Namealdehyde dehydrogenase 16 family, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45140684-45154584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45145907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 443 (Y443H)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
Predicted Effect probably benign
Transcript: ENSMUST00000107815
AA Change: Y443H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: Y443H

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000209963
AA Change: Y443H

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
Atxn2 T C 5: 121,802,267 probably null Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Crat A C 2: 30,409,982 F129V probably damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Kifap3 A T 1: 163,815,833 H209L probably benign Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp1r13l A T 7: 19,371,380 Q359L probably damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Sirt1 T C 10: 63,322,150 N495S probably benign Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap1 C A 10: 121,855,439 E297* probably null Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 45145513 missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 45141967 missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 45142093 missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 45145594 missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 45141975 missense possibly damaging 0.85
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 45147979 missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 45142838 missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 45146229 unclassified probably null
R0707:Aldh16a1 UTSW 7 45144507 unclassified probably benign
R0801:Aldh16a1 UTSW 7 45147476 missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 45142047 unclassified probably null
R1371:Aldh16a1 UTSW 7 45147250 missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 45147308 missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 45147161 critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 45148788 intron probably benign
R4859:Aldh16a1 UTSW 7 45147307 missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 45142069 missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 45144652 missense probably null 0.82
R5647:Aldh16a1 UTSW 7 45154465 missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 45147799 missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 45154407 unclassified probably benign
R5879:Aldh16a1 UTSW 7 45147506 nonsense probably null
R5890:Aldh16a1 UTSW 7 45144545 missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 45149765 missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 45146271 missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 45144937 missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 45143227 missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 45145594 missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 45147904 missense probably damaging 1.00
R7636:Aldh16a1 UTSW 7 45147531 missense unknown
R7830:Aldh16a1 UTSW 7 45146225 missense probably damaging 0.98
Z1177:Aldh16a1 UTSW 7 45145903 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGGGCACTCACATCTG -3'
(R):5'- GAGTTTGCTCTCCGACTAACGC -3'

Sequencing Primer
(F):5'- GGAAGACCCACTCTCCTTGCAG -3'
(R):5'- CCGACTAACGCTTGTCACC -3'
Posted On2019-10-07