Incidental Mutation 'R7467:Sirt1'
ID578879
Institutional Source Beutler Lab
Gene Symbol Sirt1
Ensembl Gene ENSMUSG00000020063
Gene Namesirtuin 1
SynonymsSir2, Sir2alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location63319005-63381704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63322150 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 495 (N495S)
Ref Sequence ENSEMBL: ENSMUSP00000020257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020257] [ENSMUST00000020258] [ENSMUST00000105442] [ENSMUST00000120239] [ENSMUST00000146028] [ENSMUST00000177694] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020257
AA Change: N495S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020257
Gene: ENSMUSG00000020063
AA Change: N495S

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 1.3e-62 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000020258
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105442
AA Change: N456S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101082
Gene: ENSMUSG00000020063
AA Change: N456S

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
Pfam:SIR2 214 400 4e-63 PFAM
PDB:4KXQ|B 590 609 3e-6 PDB
low complexity region 610 628 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120239
AA Change: N495S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112595
Gene: ENSMUSG00000020063
AA Change: N495S

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 6.5e-64 PFAM
PDB:4KXQ|B 629 648 4e-6 PDB
low complexity region 649 667 N/A INTRINSIC
low complexity region 672 687 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146028
SMART Domains Protein: ENSMUSP00000117819
Gene: ENSMUSG00000020063

DomainStartEndE-ValueType
Pfam:SIR2 83 140 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177694
SMART Domains Protein: ENSMUSP00000137565
Gene: ENSMUSG00000020063

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 46 94 N/A INTRINSIC
low complexity region 108 131 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
Pfam:SIR2 253 439 7.3e-63 PFAM
low complexity region 465 483 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219577
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: This gene encodes a member of the sirtuin family of proteins, characterized by their deacetylase activity and proposed role in longevity. The encoded protein regulates gene expression in a wide range of cell and tissue types through its NAD+-dependent deacetylation of histones, transcription factors and transcriptional coactivators. Brain-specific overexpression of this gene has been shown to result in increased median lifespan. Viability of homozygous knockout mice for this gene varies with strain background. Homozygous knockout mice of strains that do not exhibit embryonic lethality are sterile and have a reduced lifespan. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic and fetal lethality, abnormal embryogenesis, and abnormal cellular phenotypes of derived MEFs. Mice homozygous for other knock-out alleles may exhibit peri- and postnatal lethality and heart, mammary gland, eye, and reproductive system anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 A G 7: 45,145,907 Y443H probably benign Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
Atxn2 T C 5: 121,802,267 probably null Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Crat A C 2: 30,409,982 F129V probably damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Kifap3 A T 1: 163,815,833 H209L probably benign Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp1r13l A T 7: 19,371,380 Q359L probably damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap1 C A 10: 121,855,439 E297* probably null Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Sirt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02057:Sirt1 APN 10 63325203 missense probably damaging 1.00
IGL02106:Sirt1 APN 10 63335829 missense probably damaging 1.00
PIT4283001:Sirt1 UTSW 10 63321786 missense probably benign 0.02
R0658:Sirt1 UTSW 10 63321736 unclassified probably benign
R0724:Sirt1 UTSW 10 63323973 missense possibly damaging 0.82
R1653:Sirt1 UTSW 10 63321809 missense probably benign
R1831:Sirt1 UTSW 10 63320646 missense probably benign 0.13
R4133:Sirt1 UTSW 10 63335659 missense probably null 0.42
R4250:Sirt1 UTSW 10 63337098 critical splice acceptor site probably null
R4378:Sirt1 UTSW 10 63338949 missense probably benign 0.00
R4396:Sirt1 UTSW 10 63321998 missense probably benign 0.00
R4776:Sirt1 UTSW 10 63335722 missense probably benign 0.17
R4898:Sirt1 UTSW 10 63322004 missense probably benign 0.35
R7151:Sirt1 UTSW 10 63323996 missense probably damaging 1.00
R7365:Sirt1 UTSW 10 63322003 missense probably benign
R7773:Sirt1 UTSW 10 63326783 missense possibly damaging 0.75
RF015:Sirt1 UTSW 10 63337016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACAACTTGATTCAGATACTTC -3'
(R):5'- ATGCCCACCTCTTGACAGTTG -3'

Sequencing Primer
(F):5'- CATTAACATTGTTGTTTGTTGCTTG -3'
(R):5'- AATTAACTTCTCTTTTCTAACTCCCC -3'
Posted On2019-10-07