Incidental Mutation 'R0630:Thada'
ID57888
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 038819-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0630 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84229175 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1648 (S1648P)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably damaging
Transcript: ENSMUST00000047524
AA Change: S1648P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: S1648P

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Meta Mutation Damage Score 0.5274 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,907 probably benign Het
4930562C15Rik T A 16: 4,850,939 N731K possibly damaging Het
Adgra1 A T 7: 139,852,584 K113* probably null Het
Adgrl2 T C 3: 148,839,244 I659M probably damaging Het
Adm G T 7: 110,628,548 R41L probably damaging Het
Aimp2 T C 5: 143,906,601 E97G probably benign Het
Aox2 T C 1: 58,337,321 probably benign Het
Arhgap20 G A 9: 51,849,384 R809H probably damaging Het
Arsa T C 15: 89,474,004 probably benign Het
Atg2a G T 19: 6,244,517 A88S probably damaging Het
Atm G A 9: 53,531,622 probably benign Het
Atp1a2 A T 1: 172,291,275 I100N possibly damaging Het
BC037034 A G 5: 138,262,289 S292P probably damaging Het
Camta2 G C 11: 70,678,305 L605V probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc60 A G 5: 116,136,381 V388A possibly damaging Het
Cdk14 C T 5: 5,135,422 probably benign Het
Cdyl2 C T 8: 116,624,035 G119E probably benign Het
Celsr3 A G 9: 108,827,692 N458S probably damaging Het
Chd3 A C 11: 69,347,195 H1808Q probably damaging Het
Cntnap2 T C 6: 46,988,760 V835A probably damaging Het
Col4a1 C A 8: 11,199,889 probably benign Het
Cpsf1 A G 15: 76,601,971 V357A probably damaging Het
Cryzl1 A G 16: 91,707,219 probably benign Het
Cts8 T C 13: 61,253,442 K90R possibly damaging Het
Cux1 A G 5: 136,286,835 V1117A probably damaging Het
Dbx1 T C 7: 49,632,696 T254A probably damaging Het
Dgki C A 6: 37,000,198 C659F probably damaging Het
Dnajc1 T G 2: 18,231,801 D332A probably damaging Het
Dock8 C A 19: 25,061,160 T70K probably benign Het
Dsc1 T A 18: 20,085,862 T828S probably damaging Het
Dst T G 1: 34,193,450 V3510G probably benign Het
Dst T C 1: 34,199,473 V1738A probably damaging Het
Ehmt2 A G 17: 34,899,842 T167A probably benign Het
Eri2 A T 7: 119,786,417 V287E probably benign Het
Fat4 T A 3: 39,000,172 L4121H probably damaging Het
Fbn1 T A 2: 125,394,770 D330V possibly damaging Het
Fign A G 2: 63,980,141 Y262H possibly damaging Het
Fnd3c2 C T X: 106,239,157 M593I probably benign Het
Fndc7 T A 3: 108,876,615 E226V probably damaging Het
Gad2 A T 2: 22,690,336 Q583L probably benign Het
Gcn1l1 G A 5: 115,581,089 A334T probably benign Het
Ggt1 A G 10: 75,585,502 probably null Het
Gli2 C T 1: 118,841,918 G635R possibly damaging Het
Gm10253 T C 3: 88,739,113 E93G unknown Het
Gm10428 A G 11: 62,753,430 probably benign Het
Gm7104 T C 12: 88,285,709 noncoding transcript Het
Gm8258 T G 5: 104,776,519 noncoding transcript Het
Gpr107 A G 2: 31,214,297 N538S possibly damaging Het
Hars T C 18: 36,771,389 E190G probably damaging Het
Hoxc10 C T 15: 102,967,482 P209S probably benign Het
Ighg3 T C 12: 113,360,094 probably benign Het
Igsf10 C A 3: 59,326,062 W1750L probably damaging Het
Igsf5 C A 16: 96,372,823 probably benign Het
Itga10 T C 3: 96,656,299 probably benign Het
Ldhd T C 8: 111,627,302 K422R probably benign Het
Masp1 T C 16: 23,452,419 K693R probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mbd1 T A 18: 74,276,727 probably benign Het
Mdm4 G A 1: 132,991,753 T459I possibly damaging Het
Megf10 A T 18: 57,287,995 I902F probably benign Het
Mta3 A G 17: 83,714,627 N37S probably damaging Het
Mterf3 T A 13: 66,912,308 Y372F probably damaging Het
Nbeal2 A G 9: 110,636,034 probably benign Het
Nbr1 T C 11: 101,567,087 probably benign Het
Ndst3 A G 3: 123,562,071 M103T probably damaging Het
Notch3 C A 17: 32,147,472 probably benign Het
Npr2 A T 4: 43,641,219 E415V probably benign Het
Olfr1105 A T 2: 87,033,309 M304K probably benign Het
Olfr1286 T C 2: 111,420,846 Y35C probably damaging Het
Olfr135 A G 17: 38,208,413 H56R probably damaging Het
Olfr651 G C 7: 104,553,791 V291L probably benign Het
Olfr914 T A 9: 38,606,896 F144I probably benign Het
Pappa2 T A 1: 158,832,773 D1246V probably benign Het
Pcdhgc5 A T 18: 37,821,878 D735V probably benign Het
Pik3ca A G 3: 32,450,027 Y622C possibly damaging Het
Plppr2 A G 9: 21,947,901 D438G probably benign Het
Ppfibp2 A T 7: 107,738,599 probably null Het
Prdm15 A T 16: 97,837,707 L77Q probably null Het
Prdm8 T C 5: 98,184,521 S94P probably damaging Het
Prkdc A T 16: 15,810,801 Q3470L probably damaging Het
Prl3c1 T C 13: 27,200,691 probably benign Het
Ptchd4 A T 17: 42,377,185 H206L probably benign Het
Rack1 G A 11: 48,803,977 probably benign Het
Rere T C 4: 150,619,088 L1509P probably damaging Het
Rgma T A 7: 73,417,618 L301Q probably damaging Het
Rgs6 T A 12: 83,047,550 probably benign Het
Rictor C A 15: 6,794,492 R1613S probably damaging Het
Ripk1 T G 13: 34,027,781 F358C probably damaging Het
Robo2 T C 16: 73,916,205 D1217G probably benign Het
Shc2 A T 10: 79,626,141 W357R probably null Het
Slc25a45 T C 19: 5,880,528 L81P probably damaging Het
Slc9c1 A T 16: 45,543,120 probably benign Het
Spats2 T C 15: 99,186,028 probably null Het
Stac3 A T 10: 127,507,763 E258V probably damaging Het
Tmem168 T C 6: 13,583,065 T222A probably benign Het
Tmtc4 T C 14: 122,926,090 probably benign Het
Trim38 T G 13: 23,791,132 Y351* probably null Het
Trip12 T C 1: 84,793,915 R213G possibly damaging Het
Vav3 C T 3: 109,424,012 R76W probably damaging Het
Vmn1r63 G T 7: 5,803,264 P123H probably damaging Het
Wdr5 A G 2: 27,520,607 N130S probably benign Het
Wnk4 C A 11: 101,265,386 R27S probably damaging Het
Ykt6 G A 11: 5,959,323 S44N probably benign Het
Ythdc1 T A 5: 86,809,348 probably benign Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7882:Thada UTSW 17 84429196 missense possibly damaging 0.85
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
R8153:Thada UTSW 17 84393427 missense possibly damaging 0.90
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGGGGACTGTCACTCTGAGAGGC -3'
(R):5'- GGCAGACTACACCTCTTCAGTCATCA -3'

Sequencing Primer
(F):5'- GGCTTCTAGTCAGAAATGGCTAAAAC -3'
(R):5'- agaagaggtggagatgagagg -3'
Posted On2013-07-11