Incidental Mutation 'R7467:Srgap1'
ID578880
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7467 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 121855439 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 297 (E297*)
Ref Sequence ENSEMBL: ENSMUSP00000020322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
PDB Structure Crystal structure of srGAP1 SH3 domain in the slit-robo signaling pathway [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000020322
AA Change: E297*
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: E297*

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081688
AA Change: E297*
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: E297*

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 55,791,952 V153I probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 A G 7: 45,145,907 Y443H probably benign Het
Apbb1 A G 7: 105,566,132 V434A probably benign Het
Atrip A G 9: 109,069,354 M199T probably damaging Het
Atxn2 T C 5: 121,802,267 probably null Het
AU040320 A G 4: 126,814,310 T240A probably benign Het
Btf3l4 A T 4: 108,818,392 probably null Het
Ccdc106 A G 7: 5,060,326 T277A probably damaging Het
Cdk15 G T 1: 59,289,779 W282L probably null Het
Cflar T A 1: 58,726,438 M1K probably null Het
Champ1 C A 8: 13,878,579 P246T possibly damaging Het
Crat A C 2: 30,409,982 F129V probably damaging Het
Csmd3 T C 15: 47,629,244 N2256S Het
Cwh43 C A 5: 73,411,968 Q118K probably damaging Het
Daam1 A T 12: 71,985,806 K949* probably null Het
Ddn C G 15: 98,805,366 E682Q possibly damaging Het
Des T A 1: 75,362,961 M321K possibly damaging Het
Dnm2 T C 9: 21,481,376 V460A probably damaging Het
Dst G A 1: 34,191,155 E2610K probably benign Het
Efr3a C T 15: 65,857,511 T660I possibly damaging Het
Eogt T C 6: 97,142,833 E138G probably benign Het
Epha8 G A 4: 136,931,088 A992V possibly damaging Het
Exoc2 A T 13: 30,925,733 D217E probably damaging Het
Fam222b T C 11: 78,154,347 S245P probably damaging Het
Fbxo45 T C 16: 32,238,521 Y185C probably damaging Het
Fbxo47 T C 11: 97,865,167 T170A probably benign Het
Fbxw26 A T 9: 109,732,697 V143E probably benign Het
Foxb2 T C 19: 16,873,640 M1V probably null Het
Gm11596 C A 11: 99,793,136 V53L unknown Het
Gm37596 T A 3: 93,692,958 T35S probably benign Het
Gm47791 A G 1: 82,770,826 *140Q probably null Het
Gpr179 C T 11: 97,335,289 M2013I probably benign Het
Hck T A 2: 153,129,930 L137* probably null Het
Hectd4 T A 5: 121,323,961 C964S possibly damaging Het
Hexa T C 9: 59,557,400 probably null Het
Ifna12 C A 4: 88,603,265 S15I possibly damaging Het
Kif18b C A 11: 102,916,408 V34L probably damaging Het
Kif18b A T 11: 102,912,348 probably null Het
Kifap3 A T 1: 163,815,833 H209L probably benign Het
Klhl1 A T 14: 96,123,277 D712E probably damaging Het
Kmt2c T C 5: 25,308,532 D3088G probably damaging Het
Mageb3 A G 2: 121,954,472 Y250H probably damaging Het
Manba G T 3: 135,544,801 E396D probably damaging Het
Mapkbp1 T A 2: 120,022,188 V997E probably damaging Het
Mdc1 A G 17: 35,844,556 H41R probably benign Het
Mis18a T G 16: 90,719,978 M179L probably benign Het
Mmp25 C G 17: 23,644,782 G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 P286S probably benign Het
Mrgpra2b G A 7: 47,464,529 H152Y possibly damaging Het
Mslnl A T 17: 25,736,921 M1L probably benign Het
Myo1d G A 11: 80,586,917 T880I probably damaging Het
Ncaph T A 2: 127,133,875 probably benign Het
Nln T C 13: 104,025,022 D680G possibly damaging Het
Noct C T 3: 51,225,201 A33V probably benign Het
Nolc1 A G 19: 46,082,334 T325A unknown Het
Nr2e3 A G 9: 59,949,151 probably null Het
Nrg2 T A 18: 36,022,406 H450L probably benign Het
Olfr1414 T A 1: 92,511,848 Y60F possibly damaging Het
Olfr1434 T A 19: 12,283,475 C142* probably null Het
Olfr224 A C 11: 58,566,462 N294K possibly damaging Het
Olfr532 T C 7: 140,419,374 N133S probably benign Het
Olfr994 T G 2: 85,430,827 M1L possibly damaging Het
Pank2 T A 2: 131,274,047 N128K possibly damaging Het
Pcdha3 T C 18: 36,947,531 V442A probably damaging Het
Pds5b T A 5: 150,736,327 S252T probably damaging Het
Pfpl T C 19: 12,428,514 L43S probably damaging Het
Pigu T A 2: 155,299,089 I295F probably damaging Het
Piwil4 T C 9: 14,705,041 Y673C probably damaging Het
Pls1 A G 9: 95,769,113 Y414H possibly damaging Het
Ppp1r13l A T 7: 19,371,380 Q359L probably damaging Het
Ppp2r5c A G 12: 110,552,883 Y263C probably damaging Het
Prrc2c A T 1: 162,677,363 S2638R possibly damaging Het
Prss39 T A 1: 34,499,392 probably null Het
Psmd1 G A 1: 86,116,633 V648M probably damaging Het
Rad50 T C 11: 53,654,908 D1196G probably damaging Het
Rfx1 T C 8: 84,073,913 Y48H possibly damaging Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rpl9 T C 5: 65,390,967 T9A probably benign Het
Samd4 A G 14: 47,087,856 N598D probably benign Het
Sema7a T C 9: 57,961,422 Y606H probably damaging Het
Sf3b3 A G 8: 110,811,456 S1150P possibly damaging Het
Sirt1 T C 10: 63,322,150 N495S probably benign Het
Slc17a3 T C 13: 23,846,967 probably null Het
Slc25a22 T C 7: 141,433,976 T24A probably benign Het
Slc30a9 T C 5: 67,345,644 I363T probably benign Het
Srbd1 A G 17: 86,099,274 V561A probably damaging Het
Srgap2 T C 1: 131,292,667 S896G probably damaging Het
Sspo T C 6: 48,486,303 C3730R probably damaging Het
Stat2 T A 10: 128,277,903 probably null Het
Tcof1 T C 18: 60,831,905 K581E unknown Het
Thbs1 T C 2: 118,118,200 S446P probably damaging Het
Thsd7a T C 6: 12,331,585 Y1330C Het
Tmem121 C A 12: 113,189,070 P303T probably benign Het
Tmem87b T A 2: 128,849,151 probably null Het
Tmem98 A T 11: 80,820,185 probably null Het
Trpm3 T A 19: 22,978,334 I1091N possibly damaging Het
Urb2 A G 8: 124,028,511 E319G probably benign Het
Vmn1r170 A T 7: 23,606,895 M241L not run Het
Vmn1r238 T C 18: 3,123,393 N7S probably benign Het
Wdr6 T C 9: 108,573,002 H1109R probably benign Het
Zdhhc13 T C 7: 48,804,408 V193A probably benign Het
Zfp354c T C 11: 50,815,426 Y274C probably damaging Het
Zfp738 T A 13: 67,672,961 E89V probably benign Het
Zswim3 T A 2: 164,819,875 F92I possibly damaging Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 splice site probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 splice site probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6807:Srgap1 UTSW 10 121828726 splice site probably null
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
R7057:Srgap1 UTSW 10 121804953 missense probably benign 0.20
R7196:Srgap1 UTSW 10 121840848 missense probably benign 0.00
R7247:Srgap1 UTSW 10 121869790 missense probably damaging 0.98
R7404:Srgap1 UTSW 10 121785745 missense probably benign 0.18
R7792:Srgap1 UTSW 10 121925967 missense probably damaging 0.98
R7846:Srgap1 UTSW 10 121785492 missense probably damaging 0.97
R7896:Srgap1 UTSW 10 121853553 critical splice donor site probably benign
R7912:Srgap1 UTSW 10 121853553 critical splice donor site probably benign
R8127:Srgap1 UTSW 10 121855366 missense probably null 0.04
R8233:Srgap1 UTSW 10 121825436 missense probably damaging 1.00
R8248:Srgap1 UTSW 10 121804817 missense probably damaging 0.99
R8362:Srgap1 UTSW 10 121855478 missense possibly damaging 0.46
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTAAGAAAGAGTGCAAGGTACTC -3'
(R):5'- TGTGCTCACAGGTCACATG -3'

Sequencing Primer
(F):5'- CTACAGAGTGAGCCTGATGC -3'
(R):5'- CAGGTCACATGCGTAGGTCTTTAAC -3'
Posted On2019-10-07