Incidental Mutation 'R7467:Mslnl'
ID 578905
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission 045541-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7467 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 25955895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably benign
Transcript: ENSMUST00000047098
AA Change: M1L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,098,952 (GRCm39) V153I probably benign Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Aldh16a1 A G 7: 44,795,331 (GRCm39) Y443H probably benign Het
Apbb1 A G 7: 105,215,339 (GRCm39) V434A probably benign Het
Atrip A G 9: 108,898,422 (GRCm39) M199T probably damaging Het
Atxn2 T C 5: 121,940,330 (GRCm39) probably null Het
AU040320 A G 4: 126,708,103 (GRCm39) T240A probably benign Het
Btf3l4 A T 4: 108,675,589 (GRCm39) probably null Het
Ccdc106 A G 7: 5,063,325 (GRCm39) T277A probably damaging Het
Cdk15 G T 1: 59,328,938 (GRCm39) W282L probably null Het
Cflar T A 1: 58,765,597 (GRCm39) M1K probably null Het
Champ1 C A 8: 13,928,579 (GRCm39) P246T possibly damaging Het
Crat A C 2: 30,299,994 (GRCm39) F129V probably damaging Het
Csmd3 T C 15: 47,492,640 (GRCm39) N2256S Het
Cwh43 C A 5: 73,569,311 (GRCm39) Q118K probably damaging Het
Daam1 A T 12: 72,032,580 (GRCm39) K949* probably null Het
Ddn C G 15: 98,703,247 (GRCm39) E682Q possibly damaging Het
Des T A 1: 75,339,605 (GRCm39) M321K possibly damaging Het
Dnm2 T C 9: 21,392,672 (GRCm39) V460A probably damaging Het
Dst G A 1: 34,230,236 (GRCm39) E2610K probably benign Het
Efr3a C T 15: 65,729,360 (GRCm39) T660I possibly damaging Het
Eogt T C 6: 97,119,794 (GRCm39) E138G probably benign Het
Epha8 G A 4: 136,658,399 (GRCm39) A992V possibly damaging Het
Exoc2 A T 13: 31,109,716 (GRCm39) D217E probably damaging Het
Fam222b T C 11: 78,045,173 (GRCm39) S245P probably damaging Het
Fbxo45 T C 16: 32,057,339 (GRCm39) Y185C probably damaging Het
Fbxo47 T C 11: 97,755,993 (GRCm39) T170A probably benign Het
Fbxw26 A T 9: 109,561,765 (GRCm39) V143E probably benign Het
Foxb2 T C 19: 16,851,004 (GRCm39) M1V probably null Het
Gm11596 C A 11: 99,683,962 (GRCm39) V53L unknown Het
Gm47791 A G 1: 82,748,547 (GRCm39) *140Q probably null Het
Gpr179 C T 11: 97,226,115 (GRCm39) M2013I probably benign Het
Hck T A 2: 152,971,850 (GRCm39) L137* probably null Het
Hectd4 T A 5: 121,462,024 (GRCm39) C964S possibly damaging Het
Hexa T C 9: 59,464,683 (GRCm39) probably null Het
Ifna12 C A 4: 88,521,502 (GRCm39) S15I possibly damaging Het
Kif18b C A 11: 102,807,234 (GRCm39) V34L probably damaging Het
Kif18b A T 11: 102,803,174 (GRCm39) probably null Het
Kifap3 A T 1: 163,643,402 (GRCm39) H209L probably benign Het
Klhl1 A T 14: 96,360,713 (GRCm39) D712E probably damaging Het
Kmt2c T C 5: 25,513,530 (GRCm39) D3088G probably damaging Het
Mageb3 A G 2: 121,784,953 (GRCm39) Y250H probably damaging Het
Manba G T 3: 135,250,562 (GRCm39) E396D probably damaging Het
Mapkbp1 T A 2: 119,852,669 (GRCm39) V997E probably damaging Het
Mdc1 A G 17: 36,155,448 (GRCm39) H41R probably benign Het
Mis18a T G 16: 90,516,866 (GRCm39) M179L probably benign Het
Mmp25 C G 17: 23,863,756 (GRCm39) G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 (GRCm39) D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 (GRCm39) P286S probably benign Het
Mrgpra2b G A 7: 47,114,277 (GRCm39) H152Y possibly damaging Het
Myo1d G A 11: 80,477,743 (GRCm39) T880I probably damaging Het
Ncaph T A 2: 126,975,795 (GRCm39) probably benign Het
Nln T C 13: 104,161,530 (GRCm39) D680G possibly damaging Het
Noct C T 3: 51,132,622 (GRCm39) A33V probably benign Het
Nolc1 A G 19: 46,070,773 (GRCm39) T325A unknown Het
Nr2e3 A G 9: 59,856,434 (GRCm39) probably null Het
Nrg2 T A 18: 36,155,459 (GRCm39) H450L probably benign Het
Or13a21 T C 7: 139,999,287 (GRCm39) N133S probably benign Het
Or2t43 A C 11: 58,457,288 (GRCm39) N294K possibly damaging Het
Or5ak24 T G 2: 85,261,171 (GRCm39) M1L possibly damaging Het
Or5an1 T A 19: 12,260,839 (GRCm39) C142* probably null Het
Or6b3 T A 1: 92,439,570 (GRCm39) Y60F possibly damaging Het
Pank2 T A 2: 131,115,967 (GRCm39) N128K possibly damaging Het
Pcdha3 T C 18: 37,080,584 (GRCm39) V442A probably damaging Het
Pds5b T A 5: 150,659,792 (GRCm39) S252T probably damaging Het
Pfpl T C 19: 12,405,878 (GRCm39) L43S probably damaging Het
Pigu T A 2: 155,141,009 (GRCm39) I295F probably damaging Het
Piwil4 T C 9: 14,616,337 (GRCm39) Y673C probably damaging Het
Pls1 A G 9: 95,651,166 (GRCm39) Y414H possibly damaging Het
Ppp1r13l A T 7: 19,105,305 (GRCm39) Q359L probably damaging Het
Ppp2r5c A G 12: 110,519,317 (GRCm39) Y263C probably damaging Het
Prrc2c A T 1: 162,504,932 (GRCm39) S2638R possibly damaging Het
Prss39 T A 1: 34,538,473 (GRCm39) probably null Het
Psmd1 G A 1: 86,044,355 (GRCm39) V648M probably damaging Het
Rad50 T C 11: 53,545,735 (GRCm39) D1196G probably damaging Het
Rfx1 T C 8: 84,800,542 (GRCm39) Y48H possibly damaging Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rpl9 T C 5: 65,548,310 (GRCm39) T9A probably benign Het
Samd4 A G 14: 47,325,313 (GRCm39) N598D probably benign Het
Sema7a T C 9: 57,868,705 (GRCm39) Y606H probably damaging Het
Sf3b3 A G 8: 111,538,088 (GRCm39) S1150P possibly damaging Het
Sirt1 T C 10: 63,157,929 (GRCm39) N495S probably benign Het
Slc17a3 T C 13: 24,030,950 (GRCm39) probably null Het
Slc25a22 T C 7: 141,013,889 (GRCm39) T24A probably benign Het
Slc30a9 T C 5: 67,502,987 (GRCm39) I363T probably benign Het
Srbd1 A G 17: 86,406,702 (GRCm39) V561A probably damaging Het
Srgap1 C A 10: 121,691,344 (GRCm39) E297* probably null Het
Srgap2 T C 1: 131,220,405 (GRCm39) S896G probably damaging Het
Sspo T C 6: 48,463,237 (GRCm39) C3730R probably damaging Het
Stat2 T A 10: 128,113,772 (GRCm39) probably null Het
Tcof1 T C 18: 60,964,977 (GRCm39) K581E unknown Het
Tdpoz6 T A 3: 93,600,265 (GRCm39) T35S probably benign Het
Thbs1 T C 2: 117,948,681 (GRCm39) S446P probably damaging Het
Thsd7a T C 6: 12,331,584 (GRCm39) Y1330C Het
Tmem121 C A 12: 113,152,690 (GRCm39) P303T probably benign Het
Tmem87b T A 2: 128,691,071 (GRCm39) probably null Het
Tmem98 A T 11: 80,711,011 (GRCm39) probably null Het
Trpm3 T A 19: 22,955,698 (GRCm39) I1091N possibly damaging Het
Urb2 A G 8: 124,755,250 (GRCm39) E319G probably benign Het
Vmn1r170 A T 7: 23,306,320 (GRCm39) M241L not run Het
Vmn1r238 T C 18: 3,123,393 (GRCm39) N7S probably benign Het
Wdr6 T C 9: 108,450,201 (GRCm39) H1109R probably benign Het
Zdhhc13 T C 7: 48,454,156 (GRCm39) V193A probably benign Het
Zfp354c T C 11: 50,706,253 (GRCm39) Y274C probably damaging Het
Zfp738 T A 13: 67,821,080 (GRCm39) E89V probably benign Het
Zswim3 T A 2: 164,661,795 (GRCm39) F92I possibly damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
R9264:Mslnl UTSW 17 25,961,506 (GRCm39) intron probably benign
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGTTTTCCTCTCCAGGCAGG -3'
(R):5'- ACACTAGCTGTCCTGTGTCC -3'

Sequencing Primer
(F):5'- GATCAGGTACCCTTCGAGATG -3'
(R):5'- TGTGTCCCAGGGAGCTCAG -3'
Posted On 2019-10-07