Incidental Mutation 'R7467:Nolc1'
ID 578917
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Name nucleolar and coiled-body phosphoprotein 1
Synonyms 3230402K17Rik, P130, NOPP140
MMRRC Submission 045541-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7467 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46064302-46073969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46070773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 325 (T325A)
Ref Sequence ENSEMBL: ENSMUSP00000128331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
AlphaFold E9Q5C9
Predicted Effect unknown
Transcript: ENSMUST00000165017
AA Change: T325A
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176
AA Change: T325A

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000223728
AA Change: T323A
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect unknown
Transcript: ENSMUST00000225780
AA Change: T324A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (103/105)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 G A 17: 56,098,952 (GRCm39) V153I probably benign Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Aldh16a1 A G 7: 44,795,331 (GRCm39) Y443H probably benign Het
Apbb1 A G 7: 105,215,339 (GRCm39) V434A probably benign Het
Atrip A G 9: 108,898,422 (GRCm39) M199T probably damaging Het
Atxn2 T C 5: 121,940,330 (GRCm39) probably null Het
AU040320 A G 4: 126,708,103 (GRCm39) T240A probably benign Het
Btf3l4 A T 4: 108,675,589 (GRCm39) probably null Het
Ccdc106 A G 7: 5,063,325 (GRCm39) T277A probably damaging Het
Cdk15 G T 1: 59,328,938 (GRCm39) W282L probably null Het
Cflar T A 1: 58,765,597 (GRCm39) M1K probably null Het
Champ1 C A 8: 13,928,579 (GRCm39) P246T possibly damaging Het
Crat A C 2: 30,299,994 (GRCm39) F129V probably damaging Het
Csmd3 T C 15: 47,492,640 (GRCm39) N2256S Het
Cwh43 C A 5: 73,569,311 (GRCm39) Q118K probably damaging Het
Daam1 A T 12: 72,032,580 (GRCm39) K949* probably null Het
Ddn C G 15: 98,703,247 (GRCm39) E682Q possibly damaging Het
Des T A 1: 75,339,605 (GRCm39) M321K possibly damaging Het
Dnm2 T C 9: 21,392,672 (GRCm39) V460A probably damaging Het
Dst G A 1: 34,230,236 (GRCm39) E2610K probably benign Het
Efr3a C T 15: 65,729,360 (GRCm39) T660I possibly damaging Het
Eogt T C 6: 97,119,794 (GRCm39) E138G probably benign Het
Epha8 G A 4: 136,658,399 (GRCm39) A992V possibly damaging Het
Exoc2 A T 13: 31,109,716 (GRCm39) D217E probably damaging Het
Fam222b T C 11: 78,045,173 (GRCm39) S245P probably damaging Het
Fbxo45 T C 16: 32,057,339 (GRCm39) Y185C probably damaging Het
Fbxo47 T C 11: 97,755,993 (GRCm39) T170A probably benign Het
Fbxw26 A T 9: 109,561,765 (GRCm39) V143E probably benign Het
Foxb2 T C 19: 16,851,004 (GRCm39) M1V probably null Het
Gm11596 C A 11: 99,683,962 (GRCm39) V53L unknown Het
Gm47791 A G 1: 82,748,547 (GRCm39) *140Q probably null Het
Gpr179 C T 11: 97,226,115 (GRCm39) M2013I probably benign Het
Hck T A 2: 152,971,850 (GRCm39) L137* probably null Het
Hectd4 T A 5: 121,462,024 (GRCm39) C964S possibly damaging Het
Hexa T C 9: 59,464,683 (GRCm39) probably null Het
Ifna12 C A 4: 88,521,502 (GRCm39) S15I possibly damaging Het
Kif18b C A 11: 102,807,234 (GRCm39) V34L probably damaging Het
Kif18b A T 11: 102,803,174 (GRCm39) probably null Het
Kifap3 A T 1: 163,643,402 (GRCm39) H209L probably benign Het
Klhl1 A T 14: 96,360,713 (GRCm39) D712E probably damaging Het
Kmt2c T C 5: 25,513,530 (GRCm39) D3088G probably damaging Het
Mageb3 A G 2: 121,784,953 (GRCm39) Y250H probably damaging Het
Manba G T 3: 135,250,562 (GRCm39) E396D probably damaging Het
Mapkbp1 T A 2: 119,852,669 (GRCm39) V997E probably damaging Het
Mdc1 A G 17: 36,155,448 (GRCm39) H41R probably benign Het
Mis18a T G 16: 90,516,866 (GRCm39) M179L probably benign Het
Mmp25 C G 17: 23,863,756 (GRCm39) G25R possibly damaging Het
Mmp3 A G 9: 7,447,621 (GRCm39) D202G possibly damaging Het
Mmp3 C T 9: 7,450,125 (GRCm39) P286S probably benign Het
Mrgpra2b G A 7: 47,114,277 (GRCm39) H152Y possibly damaging Het
Mslnl A T 17: 25,955,895 (GRCm39) M1L probably benign Het
Myo1d G A 11: 80,477,743 (GRCm39) T880I probably damaging Het
Ncaph T A 2: 126,975,795 (GRCm39) probably benign Het
Nln T C 13: 104,161,530 (GRCm39) D680G possibly damaging Het
Noct C T 3: 51,132,622 (GRCm39) A33V probably benign Het
Nr2e3 A G 9: 59,856,434 (GRCm39) probably null Het
Nrg2 T A 18: 36,155,459 (GRCm39) H450L probably benign Het
Or13a21 T C 7: 139,999,287 (GRCm39) N133S probably benign Het
Or2t43 A C 11: 58,457,288 (GRCm39) N294K possibly damaging Het
Or5ak24 T G 2: 85,261,171 (GRCm39) M1L possibly damaging Het
Or5an1 T A 19: 12,260,839 (GRCm39) C142* probably null Het
Or6b3 T A 1: 92,439,570 (GRCm39) Y60F possibly damaging Het
Pank2 T A 2: 131,115,967 (GRCm39) N128K possibly damaging Het
Pcdha3 T C 18: 37,080,584 (GRCm39) V442A probably damaging Het
Pds5b T A 5: 150,659,792 (GRCm39) S252T probably damaging Het
Pfpl T C 19: 12,405,878 (GRCm39) L43S probably damaging Het
Pigu T A 2: 155,141,009 (GRCm39) I295F probably damaging Het
Piwil4 T C 9: 14,616,337 (GRCm39) Y673C probably damaging Het
Pls1 A G 9: 95,651,166 (GRCm39) Y414H possibly damaging Het
Ppp1r13l A T 7: 19,105,305 (GRCm39) Q359L probably damaging Het
Ppp2r5c A G 12: 110,519,317 (GRCm39) Y263C probably damaging Het
Prrc2c A T 1: 162,504,932 (GRCm39) S2638R possibly damaging Het
Prss39 T A 1: 34,538,473 (GRCm39) probably null Het
Psmd1 G A 1: 86,044,355 (GRCm39) V648M probably damaging Het
Rad50 T C 11: 53,545,735 (GRCm39) D1196G probably damaging Het
Rfx1 T C 8: 84,800,542 (GRCm39) Y48H possibly damaging Het
Rgs20 A G 1: 4,982,553 (GRCm39) I305T probably benign Het
Rpl9 T C 5: 65,548,310 (GRCm39) T9A probably benign Het
Samd4 A G 14: 47,325,313 (GRCm39) N598D probably benign Het
Sema7a T C 9: 57,868,705 (GRCm39) Y606H probably damaging Het
Sf3b3 A G 8: 111,538,088 (GRCm39) S1150P possibly damaging Het
Sirt1 T C 10: 63,157,929 (GRCm39) N495S probably benign Het
Slc17a3 T C 13: 24,030,950 (GRCm39) probably null Het
Slc25a22 T C 7: 141,013,889 (GRCm39) T24A probably benign Het
Slc30a9 T C 5: 67,502,987 (GRCm39) I363T probably benign Het
Srbd1 A G 17: 86,406,702 (GRCm39) V561A probably damaging Het
Srgap1 C A 10: 121,691,344 (GRCm39) E297* probably null Het
Srgap2 T C 1: 131,220,405 (GRCm39) S896G probably damaging Het
Sspo T C 6: 48,463,237 (GRCm39) C3730R probably damaging Het
Stat2 T A 10: 128,113,772 (GRCm39) probably null Het
Tcof1 T C 18: 60,964,977 (GRCm39) K581E unknown Het
Tdpoz6 T A 3: 93,600,265 (GRCm39) T35S probably benign Het
Thbs1 T C 2: 117,948,681 (GRCm39) S446P probably damaging Het
Thsd7a T C 6: 12,331,584 (GRCm39) Y1330C Het
Tmem121 C A 12: 113,152,690 (GRCm39) P303T probably benign Het
Tmem87b T A 2: 128,691,071 (GRCm39) probably null Het
Tmem98 A T 11: 80,711,011 (GRCm39) probably null Het
Trpm3 T A 19: 22,955,698 (GRCm39) I1091N possibly damaging Het
Urb2 A G 8: 124,755,250 (GRCm39) E319G probably benign Het
Vmn1r170 A T 7: 23,306,320 (GRCm39) M241L not run Het
Vmn1r238 T C 18: 3,123,393 (GRCm39) N7S probably benign Het
Wdr6 T C 9: 108,450,201 (GRCm39) H1109R probably benign Het
Zdhhc13 T C 7: 48,454,156 (GRCm39) V193A probably benign Het
Zfp354c T C 11: 50,706,253 (GRCm39) Y274C probably damaging Het
Zfp738 T A 13: 67,821,080 (GRCm39) E89V probably benign Het
Zswim3 T A 2: 164,661,795 (GRCm39) F92I possibly damaging Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46,071,468 (GRCm39) unclassified probably benign
FR4976:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
FR4976:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R0106:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R0121:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0140:Nolc1 UTSW 19 46,069,817 (GRCm39) unclassified probably benign
R0501:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46,072,598 (GRCm39) missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46,068,528 (GRCm39) splice site probably benign
R1553:Nolc1 UTSW 19 46,069,814 (GRCm39) small insertion probably benign
R1642:Nolc1 UTSW 19 46,067,461 (GRCm39) critical splice donor site probably null
R1698:Nolc1 UTSW 19 46,069,870 (GRCm39) splice site probably null
R2067:Nolc1 UTSW 19 46,072,046 (GRCm39) missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46,069,800 (GRCm39) small insertion probably benign
R2113:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,807 (GRCm39) small insertion probably benign
R2300:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R2895:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R2999:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R3737:Nolc1 UTSW 19 46,069,816 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,792 (GRCm39) small insertion probably benign
R3737:Nolc1 UTSW 19 46,069,809 (GRCm39) small insertion probably benign
R3747:Nolc1 UTSW 19 46,069,795 (GRCm39) small insertion probably benign
R3806:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,791 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
R3807:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
R4035:Nolc1 UTSW 19 46,069,797 (GRCm39) small insertion probably benign
R4619:Nolc1 UTSW 19 46,071,959 (GRCm39) missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R4999:Nolc1 UTSW 19 46,067,359 (GRCm39) missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46,070,103 (GRCm39) nonsense probably null
R5559:Nolc1 UTSW 19 46,071,594 (GRCm39) small deletion probably benign
R5837:Nolc1 UTSW 19 46,071,622 (GRCm39) unclassified probably benign
R6457:Nolc1 UTSW 19 46,071,509 (GRCm39) unclassified probably benign
R7497:Nolc1 UTSW 19 46,071,257 (GRCm39) missense probably benign 0.23
R8011:Nolc1 UTSW 19 46,070,023 (GRCm39) missense unknown
R8806:Nolc1 UTSW 19 46,071,471 (GRCm39) missense unknown
RF027:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF031:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF034:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
RF040:Nolc1 UTSW 19 46,069,802 (GRCm39) small insertion probably benign
RF044:Nolc1 UTSW 19 46,069,810 (GRCm39) small insertion probably benign
X0050:Nolc1 UTSW 19 46,069,791 (GRCm39) small deletion probably benign
Y5377:Nolc1 UTSW 19 46,069,808 (GRCm39) small insertion probably benign
Y5379:Nolc1 UTSW 19 46,069,798 (GRCm39) small insertion probably benign
Z1088:Nolc1 UTSW 19 46,071,537 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCGGTAGACAGAGTCAG -3'
(R):5'- TCTGGGGAGAAATTGTGACATTAGG -3'

Sequencing Primer
(F):5'- TTAAACCCAGGGATTCGTGC -3'
(R):5'- AAATTGTGACATTAGGATGGGTCC -3'
Posted On 2019-10-07