Incidental Mutation 'R7468:Myo1b'
ID578919
Institutional Source Beutler Lab
Gene Symbol Myo1b
Ensembl Gene ENSMUSG00000018417
Gene Namemyosin IB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7468 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location51749765-51916071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51797480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 274 (V274E)
Ref Sequence ENSEMBL: ENSMUSP00000018561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018561] [ENSMUST00000046390] [ENSMUST00000114537] [ENSMUST00000114541] [ENSMUST00000144694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018561
AA Change: V274E

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018561
Gene: ENSMUSG00000018417
AA Change: V274E

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 4.59e0 SMART
IQ 807 829 7.07e-2 SMART
IQ 836 858 3.3e-2 SMART
Pfam:Myosin_TH1 941 1128 3e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000046390
AA Change: V274E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040447
Gene: ENSMUSG00000018417
AA Change: V274E

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 3.68e0 SMART
IQ 807 829 3.3e-2 SMART
Pfam:Myosin_TH1 911 1107 3.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114537
AA Change: V274E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110184
Gene: ENSMUSG00000018417
AA Change: V274E

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 1.6e0 SMART
Pfam:Myosin_TH1 882 1078 1.9e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114541
AA Change: V280E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110188
Gene: ENSMUSG00000018417
AA Change: V280E

DomainStartEndE-ValueType
MYSc 15 708 N/A SMART
IQ 709 731 2.37e-3 SMART
IQ 732 754 2.43e0 SMART
IQ 755 777 5.24e-5 SMART
IQ 784 806 1.6e0 SMART
Pfam:Myosin_TH1 888 1084 5.8e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144694
AA Change: V274E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114603
Gene: ENSMUSG00000018417
AA Change: V274E

DomainStartEndE-ValueType
MYSc 9 299 4.69e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (86/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T G 1: 156,622,534 N90K possibly damaging Het
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Asb14 T C 14: 26,900,848 V89A probably benign Het
Banp T G 8: 121,949,849 probably null Het
BC051142 T A 17: 34,417,565 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cd1d2 A T 3: 86,988,276 probably null Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Chrdl2 T C 7: 100,010,125 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Dnm3 G A 1: 162,321,629 probably null Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hectd1 T C 12: 51,744,805 probably null Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Lrmp C A 6: 145,173,701 probably null Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Myh2 G A 11: 67,192,542 A1444T probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Otog T C 7: 46,264,119 V792A probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zfp874a T C 13: 67,425,604 probably null Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Myo1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myo1b APN 1 51763954 missense possibly damaging 0.94
IGL00943:Myo1b APN 1 51784487 missense probably damaging 0.97
IGL01537:Myo1b APN 1 51776351 missense possibly damaging 0.93
IGL01550:Myo1b APN 1 51784531 missense probably damaging 1.00
IGL01610:Myo1b APN 1 51776246 missense probably damaging 1.00
IGL01667:Myo1b APN 1 51760377 missense probably damaging 1.00
IGL01743:Myo1b APN 1 51782020 missense probably damaging 0.96
IGL01830:Myo1b APN 1 51797465 nonsense probably null
IGL02070:Myo1b APN 1 51794337 missense probably damaging 1.00
IGL02398:Myo1b APN 1 51757891 missense probably damaging 1.00
IGL02582:Myo1b APN 1 51781974 missense possibly damaging 0.88
IGL02685:Myo1b APN 1 51778499 missense probably damaging 1.00
IGL02938:Myo1b APN 1 51801178 splice site probably null
IGL02981:Myo1b APN 1 51778373 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0035:Myo1b UTSW 1 51778382 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0491:Myo1b UTSW 1 51755698 missense probably benign 0.05
R0959:Myo1b UTSW 1 51797087 missense probably damaging 1.00
R1171:Myo1b UTSW 1 51778525 missense probably damaging 1.00
R1440:Myo1b UTSW 1 51778558 splice site probably benign
R1539:Myo1b UTSW 1 51799563 missense probably damaging 0.97
R1616:Myo1b UTSW 1 51776315 missense probably damaging 1.00
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R2697:Myo1b UTSW 1 51863358 missense probably benign 0.04
R3034:Myo1b UTSW 1 51773247 missense possibly damaging 0.83
R3720:Myo1b UTSW 1 51776346 missense possibly damaging 0.79
R3896:Myo1b UTSW 1 51773261 missense probably damaging 0.97
R4003:Myo1b UTSW 1 51799530 critical splice donor site probably null
R4179:Myo1b UTSW 1 51778526 missense probably damaging 1.00
R4308:Myo1b UTSW 1 51883109 missense probably benign 0.01
R4444:Myo1b UTSW 1 51757919 missense probably damaging 0.99
R4679:Myo1b UTSW 1 51757973 missense possibly damaging 0.94
R4914:Myo1b UTSW 1 51824208 splice site probably null
R5343:Myo1b UTSW 1 51778537 missense probably benign 0.00
R5530:Myo1b UTSW 1 51797423 missense probably damaging 1.00
R5636:Myo1b UTSW 1 51797528 missense probably damaging 1.00
R5956:Myo1b UTSW 1 51776232 missense probably damaging 1.00
R5974:Myo1b UTSW 1 51778373 missense probably damaging 1.00
R6334:Myo1b UTSW 1 51768651 missense probably null 0.36
R6346:Myo1b UTSW 1 51784507 missense probably damaging 1.00
R6382:Myo1b UTSW 1 51774307 splice site probably null
R6757:Myo1b UTSW 1 51813048 missense probably damaging 1.00
R6952:Myo1b UTSW 1 51762509 missense probably damaging 0.99
R7101:Myo1b UTSW 1 51758001 missense probably benign 0.19
R7192:Myo1b UTSW 1 51757217 missense probably damaging 0.99
R7347:Myo1b UTSW 1 51751254 missense probably damaging 1.00
R7446:Myo1b UTSW 1 51763906 missense possibly damaging 0.87
R7503:Myo1b UTSW 1 51776602 intron probably null
R7586:Myo1b UTSW 1 51778324 missense probably damaging 0.99
R7712:Myo1b UTSW 1 51793677 missense probably damaging 1.00
R7871:Myo1b UTSW 1 51779580 missense possibly damaging 0.89
R7954:Myo1b UTSW 1 51779580 missense possibly damaging 0.89
R7988:Myo1b UTSW 1 51763884 splice site probably null
X0065:Myo1b UTSW 1 51797395 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAAGGGCGAGAACTTCAC -3'
(R):5'- TCACAGTTTGGATCCACCTATG -3'

Sequencing Primer
(F):5'- CGAGAACTTCACTGCGGTG -3'
(R):5'- ACAACAGGCACAGATGTA -3'
Posted On2019-10-07