Incidental Mutation 'R7468:Abl2'
ID578922
Institutional Source Beutler Lab
Gene Symbol Abl2
Ensembl Gene ENSMUSG00000026596
Gene Namev-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
SynonymsAbll, Arg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R7468 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location156558786-156649568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 156622534 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 90 (N90K)
Ref Sequence ENSEMBL: ENSMUSP00000027888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172] [ENSMUST00000173929] [ENSMUST00000190749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027888
AA Change: N90K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: N90K

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
low complexity region 877 891 N/A INTRINSIC
low complexity region 974 991 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
FABD 1061 1182 5.24e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166172
AA Change: N90K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: N90K

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 773 787 N/A INTRINSIC
low complexity region 870 887 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
FABD 957 1078 5.24e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173929
AA Change: N69K

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133381
Gene: ENSMUSG00000026596
AA Change: N69K

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 89 139 4.35e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190749
AA Change: N83K

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140125
Gene: ENSMUSG00000026596
AA Change: N83K

DomainStartEndE-ValueType
SH3 103 159 6.2e-18 SMART
SH2 164 247 8.4e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Asb14 T C 14: 26,900,848 V89A probably benign Het
Banp T G 8: 121,949,849 probably null Het
BC051142 T A 17: 34,417,565 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cd1d2 A T 3: 86,988,276 probably null Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Chrdl2 T C 7: 100,010,125 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Dnm3 G A 1: 162,321,629 probably null Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hectd1 T C 12: 51,744,805 probably null Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Lrmp C A 6: 145,173,701 probably null Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Myh2 G A 11: 67,192,542 A1444T probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Myo1b A T 1: 51,797,480 V274E possibly damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Otog T C 7: 46,264,119 V792A probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zfp874a T C 13: 67,425,604 probably null Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Abl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Abl2 APN 1 156635184 missense probably damaging 1.00
IGL01679:Abl2 APN 1 156642465 missense probably benign 0.01
IGL02289:Abl2 APN 1 156629854 missense probably damaging 1.00
PIT4495001:Abl2 UTSW 1 156633185 missense probably damaging 1.00
R0907:Abl2 UTSW 1 156629859 missense probably damaging 1.00
R1232:Abl2 UTSW 1 156641730 missense probably damaging 1.00
R2069:Abl2 UTSW 1 156620827 splice site probably null
R4224:Abl2 UTSW 1 156633847 missense probably damaging 0.98
R4305:Abl2 UTSW 1 156641563 missense probably damaging 0.99
R4411:Abl2 UTSW 1 156630082 missense possibly damaging 0.86
R4490:Abl2 UTSW 1 156633779 missense probably damaging 1.00
R5132:Abl2 UTSW 1 156641832 nonsense probably null
R5383:Abl2 UTSW 1 156642232 missense possibly damaging 0.89
R5428:Abl2 UTSW 1 156642111 missense probably damaging 1.00
R5436:Abl2 UTSW 1 156629880 missense probably damaging 1.00
R5760:Abl2 UTSW 1 156641857 missense probably benign 0.06
R6051:Abl2 UTSW 1 156642085 missense probably damaging 1.00
R6955:Abl2 UTSW 1 156622649 missense probably damaging 1.00
R7002:Abl2 UTSW 1 156559133 missense probably damaging 1.00
R7038:Abl2 UTSW 1 156641409 missense possibly damaging 0.95
R7172:Abl2 UTSW 1 156622587 missense probably damaging 1.00
R7268:Abl2 UTSW 1 156633939 critical splice donor site probably null
R7282:Abl2 UTSW 1 156630060 missense probably damaging 1.00
R7303:Abl2 UTSW 1 156641250 missense probably benign 0.00
R7372:Abl2 UTSW 1 156622619 missense probably damaging 1.00
R7375:Abl2 UTSW 1 156622614 missense probably damaging 1.00
R7443:Abl2 UTSW 1 156625381 missense probably damaging 1.00
R7614:Abl2 UTSW 1 156636859 missense possibly damaging 0.71
R7644:Abl2 UTSW 1 156615993 missense probably benign 0.08
R7783:Abl2 UTSW 1 156559071 missense probably benign
X0067:Abl2 UTSW 1 156631433 splice site probably null
Z1177:Abl2 UTSW 1 156641106 missense probably damaging 1.00
Z1177:Abl2 UTSW 1 156641553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTCTTGGCTTAGTCTTTGTAACG -3'
(R):5'- CAAGTCACCTGGTCAGTGTC -3'

Sequencing Primer
(F):5'- CGTTCTGAGCCTAAGTGTATACCAAC -3'
(R):5'- CACGTGGCGCTTCATGTC -3'
Posted On2019-10-07