Incidental Mutation 'R7468:Cd1d2'
ID578935
Institutional Source Beutler Lab
Gene Symbol Cd1d2
Ensembl Gene ENSMUSG00000041750
Gene NameCD1d2 antigen
SynonymsCd1b, CD1.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7468 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location86986551-86989780 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 86988276 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041920] [ENSMUST00000192481] [ENSMUST00000194208]
Predicted Effect probably null
Transcript: ENSMUST00000041920
SMART Domains Protein: ENSMUSP00000039583
Gene: ENSMUSG00000041750

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 7.1e-87 PFAM
IGc1 221 290 1.14e-16 SMART
transmembrane domain 303 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192481
Predicted Effect probably benign
Transcript: ENSMUST00000194208
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (86/88)
MGI Phenotype Homozygotes for a targeted null mutation ablating both Cd1d1 and Cd1d2 exhibit very few NK1.1-bearing T cells and an impaired interleukin 4 (IL4) response upon systemic T cell activation. Such mice are phenotypically similar to mutants lacking only Cd1d1.
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T G 1: 156,622,534 N90K possibly damaging Het
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Asb14 T C 14: 26,900,848 V89A probably benign Het
Banp T G 8: 121,949,849 probably null Het
BC051142 T A 17: 34,417,565 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Chrdl2 T C 7: 100,010,125 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Dnm3 G A 1: 162,321,629 probably null Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hectd1 T C 12: 51,744,805 probably null Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Lrmp C A 6: 145,173,701 probably null Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Myh2 G A 11: 67,192,542 A1444T probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Myo1b A T 1: 51,797,480 V274E possibly damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Otog T C 7: 46,264,119 V792A probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zfp874a T C 13: 67,425,604 probably null Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Cd1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0602:Cd1d2 UTSW 3 86987803 missense probably benign 0.13
R2210:Cd1d2 UTSW 3 86987734 missense possibly damaging 0.50
R2221:Cd1d2 UTSW 3 86988540 missense probably damaging 1.00
R2282:Cd1d2 UTSW 3 86987251 missense probably benign 0.20
R2919:Cd1d2 UTSW 3 86987680 missense probably damaging 1.00
R4573:Cd1d2 UTSW 3 86987554 missense probably benign 0.20
R4854:Cd1d2 UTSW 3 86989249 critical splice donor site probably null
R5258:Cd1d2 UTSW 3 86987647 missense possibly damaging 0.80
R5765:Cd1d2 UTSW 3 86987242 missense probably benign 0.01
R7000:Cd1d2 UTSW 3 86987773 missense probably benign 0.30
R7555:Cd1d2 UTSW 3 86987101 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCAGGTTGTTCCAGAGTAAAGAGG -3'
(R):5'- CATGTCTCATCAGCATTTGGC -3'

Sequencing Primer
(F):5'- CTACAGGGGGCTCAGATCAG -3'
(R):5'- TTGGCAGGAAATCACCTCTG -3'
Posted On2019-10-07