Incidental Mutation 'R7468:Otog'
ID578949
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R7468 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46264119 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 792 (V792A)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably benign
Transcript: ENSMUST00000164538
AA Change: V792A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: V792A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T G 1: 156,622,534 N90K possibly damaging Het
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Banp T G 8: 121,949,849 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cd1d2 A T 3: 86,988,276 probably null Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Myh2 G A 11: 67,192,542 A1444T probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Myo1b A T 1: 51,797,480 V274E possibly damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACTTCTTTGACCCTGG -3'
(R):5'- ACTTGCCTCTCCCAACAAGG -3'

Sequencing Primer
(F):5'- GGGACAGGGCAAATCTCTTACC -3'
(R):5'- AACAAGGCCTGCATGCTG -3'
Posted On2019-10-07