Incidental Mutation 'R7468:Akap13'
ID578952
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene NameA kinase (PRKA) anchor protein 13
SynonymsAKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7468 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location75455534-75754609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75730465 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 462 (R462H)
Ref Sequence ENSEMBL: ENSMUSP00000146401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
Predicted Effect probably damaging
Transcript: ENSMUST00000166315
AA Change: R2163H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: R2163H

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207239
AA Change: R462H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207750
AA Change: R2181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2115 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T G 1: 156,622,534 N90K possibly damaging Het
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Asb14 T C 14: 26,900,848 V89A probably benign Het
Banp T G 8: 121,949,849 probably null Het
BC051142 T A 17: 34,417,565 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cd1d2 A T 3: 86,988,276 probably null Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Chrdl2 T C 7: 100,010,125 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Dnm3 G A 1: 162,321,629 probably null Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hectd1 T C 12: 51,744,805 probably null Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Lrmp C A 6: 145,173,701 probably null Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Myh2 G A 11: 67,192,542 A1444T probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Myo1b A T 1: 51,797,480 V274E possibly damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Otog T C 7: 46,264,119 V792A probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zfp874a T C 13: 67,425,604 probably null Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75725971 missense probably damaging 0.99
IGL00332:Akap13 APN 7 75728919 missense probably damaging 1.00
IGL00481:Akap13 APN 7 75723895 missense probably damaging 1.00
IGL00590:Akap13 APN 7 75610669 missense probably benign 0.01
IGL00655:Akap13 APN 7 75704398 missense probably damaging 0.99
IGL00766:Akap13 APN 7 75704512 missense probably damaging 0.96
IGL00818:Akap13 APN 7 75609727 missense probably benign 0.00
IGL00826:Akap13 APN 7 75677447 missense probably damaging 1.00
IGL01014:Akap13 APN 7 75750633 utr 3 prime probably benign
IGL01090:Akap13 APN 7 75666531 missense probably benign 0.44
IGL01155:Akap13 APN 7 75569936 missense probably damaging 1.00
IGL01326:Akap13 APN 7 75725348 missense probably benign 0.30
IGL01456:Akap13 APN 7 75602847 missense probably damaging 0.98
IGL01460:Akap13 APN 7 75747846 missense probably benign 0.29
IGL01568:Akap13 APN 7 75608522 nonsense probably null 0.00
IGL01610:Akap13 APN 7 75720180 missense possibly damaging 0.71
IGL01610:Akap13 APN 7 75747605 missense probably damaging 1.00
IGL01615:Akap13 APN 7 75697393 missense probably damaging 1.00
IGL01667:Akap13 APN 7 75570019 missense probably damaging 1.00
IGL01705:Akap13 APN 7 75746767 missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75666545 missense probably benign 0.27
IGL02269:Akap13 APN 7 75602911 missense probably benign
IGL02421:Akap13 APN 7 75717806 missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75609188 missense probably damaging 0.96
IGL02944:Akap13 APN 7 75608657 missense probably benign
IGL03051:Akap13 APN 7 75610485 nonsense probably null
IGL03160:Akap13 APN 7 75730417 missense probably damaging 1.00
IGL03245:Akap13 APN 7 75609752 missense probably damaging 0.99
R0254:Akap13 UTSW 7 75736604 splice site probably benign
R0310:Akap13 UTSW 7 75614930 missense probably damaging 0.99
R0373:Akap13 UTSW 7 75609929 missense probably benign 0.00
R0373:Akap13 UTSW 7 75730500 missense probably damaging 1.00
R0408:Akap13 UTSW 7 75746796 missense probably damaging 1.00
R0631:Akap13 UTSW 7 75614996 missense probably damaging 0.99
R0646:Akap13 UTSW 7 75747746 missense probably damaging 1.00
R0781:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75725380 missense probably damaging 1.00
R1004:Akap13 UTSW 7 75687286 missense probably damaging 0.99
R1024:Akap13 UTSW 7 75677409 missense probably damaging 1.00
R1110:Akap13 UTSW 7 75611377 missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75586193 missense probably damaging 0.97
R1442:Akap13 UTSW 7 75735778 missense probably damaging 0.99
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75729049 missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75609592 missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75677194 missense probably damaging 1.00
R1773:Akap13 UTSW 7 75683451 missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1786:Akap13 UTSW 7 75611434 missense probably benign 0.16
R1791:Akap13 UTSW 7 75611035 missense probably benign 0.00
R1819:Akap13 UTSW 7 75608705 missense probably benign 0.04
R1879:Akap13 UTSW 7 75610727 missense probably benign 0.01
R1989:Akap13 UTSW 7 75704516 missense probably benign 0.01
R2016:Akap13 UTSW 7 75704531 missense probably damaging 0.99
R2092:Akap13 UTSW 7 75610570 missense probably benign 0.05
R2126:Akap13 UTSW 7 75725304 missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2132:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2133:Akap13 UTSW 7 75611434 missense probably benign 0.16
R2251:Akap13 UTSW 7 75739477 missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75666550 missense probably damaging 1.00
R3713:Akap13 UTSW 7 75586181 missense probably damaging 0.98
R3731:Akap13 UTSW 7 75611377 missense probably benign 0.39
R3765:Akap13 UTSW 7 75608837 missense probably benign 0.04
R3788:Akap13 UTSW 7 75702153 critical splice donor site probably null
R3793:Akap13 UTSW 7 75610141 missense probably benign 0.00
R3970:Akap13 UTSW 7 75569951 nonsense probably null
R4205:Akap13 UTSW 7 75610919 missense probably benign 0.05
R4257:Akap13 UTSW 7 75611285 missense probably damaging 0.98
R4374:Akap13 UTSW 7 75608984 missense probably damaging 0.96
R4448:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4450:Akap13 UTSW 7 75742760 missense probably damaging 1.00
R4457:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4458:Akap13 UTSW 7 75739465 missense probably damaging 0.99
R4466:Akap13 UTSW 7 75602773 splice site probably null
R4632:Akap13 UTSW 7 75666553 missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4669:Akap13 UTSW 7 75729094 missense probably damaging 1.00
R4671:Akap13 UTSW 7 75579564 nonsense probably null
R4821:Akap13 UTSW 7 75677507 intron probably benign
R4868:Akap13 UTSW 7 75743504 missense probably damaging 1.00
R4894:Akap13 UTSW 7 75725320 missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75749240 missense probably benign 0.22
R4962:Akap13 UTSW 7 75749430 missense probably damaging 0.98
R4988:Akap13 UTSW 7 75730528 missense probably damaging 1.00
R5119:Akap13 UTSW 7 75687252 missense probably damaging 0.98
R5141:Akap13 UTSW 7 75609614 missense probably benign 0.18
R5419:Akap13 UTSW 7 75610243 missense probably benign 0.01
R5427:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75602904 missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75602830 missense probably damaging 1.00
R5458:Akap13 UTSW 7 75586301 missense probably damaging 1.00
R5636:Akap13 UTSW 7 75704372 missense probably damaging 0.96
R5643:Akap13 UTSW 7 75702154 critical splice donor site probably null
R5898:Akap13 UTSW 7 75729146 missense probably damaging 1.00
R5932:Akap13 UTSW 7 75610184 missense probably damaging 1.00
R6135:Akap13 UTSW 7 75609908 missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75677416 missense probably damaging 1.00
R6182:Akap13 UTSW 7 75586280 missense probably benign 0.45
R6310:Akap13 UTSW 7 75749193 missense probably damaging 0.99
R6346:Akap13 UTSW 7 75685254 missense probably damaging 1.00
R6466:Akap13 UTSW 7 75727044 missense probably benign 0.01
R6605:Akap13 UTSW 7 75579768 missense probably damaging 0.98
R6617:Akap13 UTSW 7 75730363 missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75569981 missense probably damaging 1.00
R6703:Akap13 UTSW 7 75602898 missense probably damaging 1.00
R6750:Akap13 UTSW 7 75739458 missense probably benign 0.03
R7069:Akap13 UTSW 7 75610262 missense probably benign 0.29
R7116:Akap13 UTSW 7 75720195 missense probably benign 0.00
R7158:Akap13 UTSW 7 75579594 missense probably damaging 0.97
R7159:Akap13 UTSW 7 75730579 missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7471:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7472:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7477:Akap13 UTSW 7 75749247 missense probably benign
R7636:Akap13 UTSW 7 75609873 missense probably benign 0.04
R7650:Akap13 UTSW 7 75643454 missense probably benign 0.20
R7671:Akap13 UTSW 7 75569900 missense probably damaging 1.00
R7681:Akap13 UTSW 7 75728796 missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75677258 missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75610328 missense probably benign 0.00
R7816:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7817:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R7834:Akap13 UTSW 7 75742642 missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75586216 missense probably damaging 0.97
R8006:Akap13 UTSW 7 75579696 missense probably damaging 1.00
R8009:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8011:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8012:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8013:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8016:Akap13 UTSW 7 75730465 missense probably damaging 1.00
R8089:Akap13 UTSW 7 75610592 missense possibly damaging 0.94
R8174:Akap13 UTSW 7 75728869 missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75747804 missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75730552 missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75615005 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTTGGCTTGTTGACTCCAGTG -3'
(R):5'- AGGCTCAGACATGGATGCAG -3'

Sequencing Primer
(F):5'- TTGACTCCAGTGTGAAAGGGTAATC -3'
(R):5'- CAGACATGGATGCAGTCATACCTTTC -3'
Posted On2019-10-07