Incidental Mutation 'R0630:Dock8'
ID 57896
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission 038819-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0630 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25038524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 70 (T70K)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: T70K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: T70K

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.1464 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 97% (108/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 183,766,104 (GRCm39) probably benign Het
4930562C15Rik T A 16: 4,668,803 (GRCm39) N731K possibly damaging Het
Adgra1 A T 7: 139,432,500 (GRCm39) K113* probably null Het
Adgrl2 T C 3: 148,544,880 (GRCm39) I659M probably damaging Het
Adm G T 7: 110,227,755 (GRCm39) R41L probably damaging Het
Aimp2 T C 5: 143,843,419 (GRCm39) E97G probably benign Het
Aox1 T C 1: 58,376,480 (GRCm39) probably benign Het
Arhgap20 G A 9: 51,760,684 (GRCm39) R809H probably damaging Het
Arsa T C 15: 89,358,207 (GRCm39) probably benign Het
Atg2a G T 19: 6,294,547 (GRCm39) A88S probably damaging Het
Atm G A 9: 53,442,922 (GRCm39) probably benign Het
Atp1a2 A T 1: 172,118,842 (GRCm39) I100N possibly damaging Het
Camta2 G C 11: 70,569,131 (GRCm39) L605V probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Ccdc60 A G 5: 116,274,440 (GRCm39) V388A possibly damaging Het
Cdk14 C T 5: 5,185,422 (GRCm39) probably benign Het
Cdyl2 C T 8: 117,350,774 (GRCm39) G119E probably benign Het
Celsr3 A G 9: 108,704,891 (GRCm39) N458S probably damaging Het
Chd3 A C 11: 69,238,021 (GRCm39) H1808Q probably damaging Het
Cntnap2 T C 6: 46,965,694 (GRCm39) V835A probably damaging Het
Col4a1 C A 8: 11,249,889 (GRCm39) probably benign Het
Cpsf1 A G 15: 76,486,171 (GRCm39) V357A probably damaging Het
Cryzl1 A G 16: 91,504,107 (GRCm39) probably benign Het
Cts8 T C 13: 61,401,256 (GRCm39) K90R possibly damaging Het
Cux1 A G 5: 136,315,689 (GRCm39) V1117A probably damaging Het
Dbx1 T C 7: 49,282,444 (GRCm39) T254A probably damaging Het
Dgki C A 6: 36,977,133 (GRCm39) C659F probably damaging Het
Dnajc1 T G 2: 18,236,612 (GRCm39) D332A probably damaging Het
Dsc1 T A 18: 20,218,919 (GRCm39) T828S probably damaging Het
Dst T G 1: 34,232,531 (GRCm39) V3510G probably benign Het
Dst T C 1: 34,238,554 (GRCm39) V1738A probably damaging Het
Ehmt2 A G 17: 35,118,818 (GRCm39) T167A probably benign Het
Eri2 A T 7: 119,385,640 (GRCm39) V287E probably benign Het
Fat4 T A 3: 39,054,321 (GRCm39) L4121H probably damaging Het
Fbn1 T A 2: 125,236,690 (GRCm39) D330V possibly damaging Het
Fign A G 2: 63,810,485 (GRCm39) Y262H possibly damaging Het
Fnd3c2 C T X: 105,282,763 (GRCm39) M593I probably benign Het
Fndc7 T A 3: 108,783,931 (GRCm39) E226V probably damaging Het
Gad2 A T 2: 22,580,348 (GRCm39) Q583L probably benign Het
Gcn1 G A 5: 115,719,148 (GRCm39) A334T probably benign Het
Ggt1 A G 10: 75,421,336 (GRCm39) probably null Het
Gli2 C T 1: 118,769,648 (GRCm39) G635R possibly damaging Het
Gm10253 T C 3: 88,646,420 (GRCm39) E93G unknown Het
Gm10428 A G 11: 62,644,256 (GRCm39) probably benign Het
Gm7104 T C 12: 88,252,479 (GRCm39) noncoding transcript Het
Gm8258 T G 5: 104,924,385 (GRCm39) noncoding transcript Het
Gpr107 A G 2: 31,104,309 (GRCm39) N538S possibly damaging Het
Hars1 T C 18: 36,904,442 (GRCm39) E190G probably damaging Het
Hoxc10 C T 15: 102,875,917 (GRCm39) P209S probably benign Het
Ighg3 T C 12: 113,323,714 (GRCm39) probably benign Het
Igsf10 C A 3: 59,233,483 (GRCm39) W1750L probably damaging Het
Igsf5 C A 16: 96,174,023 (GRCm39) probably benign Het
Itga10 T C 3: 96,563,615 (GRCm39) probably benign Het
Ldhd T C 8: 112,353,934 (GRCm39) K422R probably benign Het
Masp1 T C 16: 23,271,169 (GRCm39) K693R probably benign Het
Mb21d2 G A 16: 28,748,324 (GRCm39) A31V probably benign Het
Mbd1 T A 18: 74,409,798 (GRCm39) probably benign Het
Mdm4 G A 1: 132,919,491 (GRCm39) T459I possibly damaging Het
Megf10 A T 18: 57,421,067 (GRCm39) I902F probably benign Het
Mta3 A G 17: 84,022,056 (GRCm39) N37S probably damaging Het
Mterf3 T A 13: 67,060,372 (GRCm39) Y372F probably damaging Het
Nbeal2 A G 9: 110,465,102 (GRCm39) probably benign Het
Nbr1 T C 11: 101,457,913 (GRCm39) probably benign Het
Ndst3 A G 3: 123,355,720 (GRCm39) M103T probably damaging Het
Notch3 C A 17: 32,366,446 (GRCm39) probably benign Het
Npr2 A T 4: 43,641,219 (GRCm39) E415V probably benign Het
Or2n1c A G 17: 38,519,304 (GRCm39) H56R probably damaging Het
Or4k40 T C 2: 111,251,191 (GRCm39) Y35C probably damaging Het
Or52h9 G C 7: 104,202,998 (GRCm39) V291L probably benign Het
Or5be3 A T 2: 86,863,653 (GRCm39) M304K probably benign Het
Or8b50 T A 9: 38,518,192 (GRCm39) F144I probably benign Het
Pappa2 T A 1: 158,660,343 (GRCm39) D1246V probably benign Het
Pcdhgc5 A T 18: 37,954,931 (GRCm39) D735V probably benign Het
Pik3ca A G 3: 32,504,176 (GRCm39) Y622C possibly damaging Het
Plppr2 A G 9: 21,859,197 (GRCm39) D438G probably benign Het
Ppfibp2 A T 7: 107,337,806 (GRCm39) probably null Het
Prdm15 A T 16: 97,638,907 (GRCm39) L77Q probably null Het
Prdm8 T C 5: 98,332,380 (GRCm39) S94P probably damaging Het
Prkdc A T 16: 15,628,665 (GRCm39) Q3470L probably damaging Het
Prl3c1 T C 13: 27,384,674 (GRCm39) probably benign Het
Ptchd4 A T 17: 42,688,076 (GRCm39) H206L probably benign Het
Rack1 G A 11: 48,694,804 (GRCm39) probably benign Het
Rere T C 4: 150,703,545 (GRCm39) L1509P probably damaging Het
Rgma T A 7: 73,067,366 (GRCm39) L301Q probably damaging Het
Rgs6 T A 12: 83,094,324 (GRCm39) probably benign Het
Rictor C A 15: 6,823,973 (GRCm39) R1613S probably damaging Het
Ripk1 T G 13: 34,211,764 (GRCm39) F358C probably damaging Het
Robo2 T C 16: 73,713,093 (GRCm39) D1217G probably benign Het
Shc2 A T 10: 79,461,975 (GRCm39) W357R probably null Het
Slc25a45 T C 19: 5,930,556 (GRCm39) L81P probably damaging Het
Slc9c1 A T 16: 45,363,483 (GRCm39) probably benign Het
Spats2 T C 15: 99,083,909 (GRCm39) probably null Het
Stac3 A T 10: 127,343,632 (GRCm39) E258V probably damaging Het
Thada A G 17: 84,536,603 (GRCm39) S1648P probably damaging Het
Tmem168 T C 6: 13,583,064 (GRCm39) T222A probably benign Het
Tmtc4 T C 14: 123,163,502 (GRCm39) probably benign Het
Trappc14 A G 5: 138,260,551 (GRCm39) S292P probably damaging Het
Trim38 T G 13: 23,975,115 (GRCm39) Y351* probably null Het
Trip12 T C 1: 84,771,636 (GRCm39) R213G possibly damaging Het
Vav3 C T 3: 109,331,328 (GRCm39) R76W probably damaging Het
Vmn1r63 G T 7: 5,806,263 (GRCm39) P123H probably damaging Het
Wdr5 A G 2: 27,410,619 (GRCm39) N130S probably benign Het
Wnk4 C A 11: 101,156,212 (GRCm39) R27S probably damaging Het
Ykt6 G A 11: 5,909,323 (GRCm39) S44N probably benign Het
Ythdc1 T A 5: 86,957,207 (GRCm39) probably benign Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTCATCAGGCTGCAATTAAGCCG -3'
(R):5'- GTTCAGAATCAGCACCCTTCCCATC -3'

Sequencing Primer
(F):5'- CCAGTCGCTTCATTTAGGCTAAAAG -3'
(R):5'- AGCACCCTTCCCATCTCATATTTTC -3'
Posted On 2013-07-11