Incidental Mutation 'R7468:Myh2'
ID578970
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R7468 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67192542 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1444 (A1444T)
Ref Sequence ENSEMBL: ENSMUSP00000018641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably benign
Transcript: ENSMUST00000018641
AA Change: A1444T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: A1444T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170159
AA Change: A1444T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: A1444T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T G 1: 156,622,534 N90K possibly damaging Het
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Banp T G 8: 121,949,849 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cd1d2 A T 3: 86,988,276 probably null Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Myo1b A T 1: 51,797,480 V274E possibly damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Otog T C 7: 46,264,119 V792A probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5750:Myh2 UTSW 11 67191428 missense probably benign
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACCCTAGTGAATCTTGTCATGTG -3'
(R):5'- CAGCGTGGGTTTCCTCATAC -3'

Sequencing Primer
(F):5'- CTTGTCATGTGAATGAATGACATCAC -3'
(R):5'- AGCGTGGGTTTCCTCATACTTCTG -3'
Posted On2019-10-07