Mutagenetix > Incidental Mutation

Incidental Mutation 'R7469:Abtb2'

579008

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7469 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103566947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 74 (V74A)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: V74A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: V74A

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (77/79)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,368,188	L443P	probably damaging	Het
Adam5	A	T	8: 24,815,525	F66I	probably benign	Het
Aff1	T	A	5: 103,833,547	D517E	probably benign	Het
Agbl3	A	G	6: 34,814,414	K559R	probably damaging	Het
Aldh1l2	A	C	10: 83,508,105	V482G	probably damaging	Het
Ankra2	C	T	13: 98,266,374	A43V	probably benign	Het
Ankrd50	C	A	3: 38,454,193	V419F	probably damaging	Het
Arhgef16	G	A	4: 154,291,306	T77M	probably damaging	Het
Best3	T	C	10: 117,004,385	V240A	probably damaging	Het
Btbd7	T	C	12: 102,812,768	Y413C	probably damaging	Het
Bzw2	A	T	12: 36,107,551	V305E	probably damaging	Het
Cacng8	G	A	7: 3,415,105	A258T	possibly damaging	Het
Cfap157	T	C	2: 32,780,684	Y184C	probably damaging	Het
Chmp3	T	A	6: 71,579,668	V184E	possibly damaging	Het
Cst10	C	T	2: 149,405,576	L71F	probably benign	Het
Ctdspl2	A	T	2: 122,006,881	E376D	possibly damaging	Het
Cyfip1	A	G	7: 55,877,720	D200G	possibly damaging	Het
Cylc2	T	A	4: 51,227,970		probably null	Het
Cyp2c66	T	A	19: 39,183,863	F407L	probably damaging	Het
Dcp2	T	C	18: 44,395,952	F45L	probably damaging	Het
Dhx34	C	T	7: 16,216,439	R268H	probably benign	Het
Dnajc7	A	T	11: 100,591,551	M205K	probably benign	Het
Dzip3	C	T	16: 48,944,879	V491M	probably benign	Het
Fam160a1	T	C	3: 85,672,762	D712G	probably benign	Het
Farp1	T	C	14: 121,275,421	L777P	probably damaging	Het
Fchsd2	T	G	7: 101,278,656		probably null	Het
Fer1l6	A	T	15: 58,590,570		probably null	Het
Fitm2	A	G	2: 163,469,822	F157S	probably damaging	Het
Flt1	G	T	5: 147,603,569	A770E	probably damaging	Het
Flt3	T	A	5: 147,331,274	E967V	probably benign	Het
Foxc1	G	C	13: 31,808,378	A391P	unknown	Het
Foxc1	C	T	13: 31,808,379	A391V	unknown	Het
Gimap6	T	A	6: 48,702,458	T215S	probably benign	Het
Gm2431	A	T	7: 142,257,781	C129S	unknown	Het
Itpr3	T	C	17: 27,121,054	S2636P	possibly damaging	Het
Lsg1	A	G	16: 30,561,817	Y601H	probably benign	Het
Map4	G	T	9: 110,027,797		probably null	Het
Mga	T	C	2: 119,903,046	M125T	probably damaging	Het
Mxi1	A	G	19: 53,371,660	D271G	probably damaging	Het
Ndst3	T	A	3: 123,671,661	T221S	possibly damaging	Het
Neto1	T	A	18: 86,498,688	S377T	probably benign	Het
Nkx6-2	T	C	7: 139,581,639	E210G	probably damaging	Het
Nos2	G	T	11: 78,952,971	V915F	possibly damaging	Het
Nrros	G	A	16: 32,144,212	A329V	probably benign	Het
Numb	T	C	12: 83,803,804	K211E	probably benign	Het
Nup210	T	A	6: 91,018,892	I1671F	probably benign	Het
Olfr1183	T	A	2: 88,461,347	H2Q	probably benign	Het
Olfr1204	T	A	2: 88,852,503	D184E	probably benign	Het
Olfr530	G	A	7: 140,373,137	L158F	possibly damaging	Het
Pcdh15	A	T	10: 74,645,980	M386L	probably benign	Het
Pcdhb3	C	A	18: 37,301,335	T118K	probably benign	Het
Pcdhb8	A	T	18: 37,355,958	I230F	probably damaging	Het
Peli2	G	A	14: 48,250,558	V120I	probably benign	Het
Pramef20	T	A	4: 144,373,103	Q364L	probably damaging	Het
Pramel7	T	A	2: 87,491,404	M96L	probably benign	Het
Prex2	T	A	1: 11,285,069	S1531R	probably damaging	Het
Prpf31	A	G	7: 3,633,393	T138A	possibly damaging	Het
Psme4	C	T	11: 30,802,837	T175I	probably benign	Het
Rasgrf2	A	G	13: 92,029,022		probably null	Het
Rps19	T	A	7: 24,889,765	*146K	probably null	Het
Rsu1	T	C	2: 13,077,560	N260S	probably benign	Het
Serpina3k	T	C	12: 104,345,335	C391R	not run	Het
Sipa1l1	T	G	12: 82,420,664		probably null	Het
Snd1	T	A	6: 28,626,127	Y394N	probably damaging	Het
Spaca4	A	T	7: 45,725,407	V57E	probably damaging	Het
Spata31d1b	A	G	13: 59,715,464	Y142C	probably benign	Het
Sptbn2	A	G	19: 4,745,118	K1535E	probably benign	Het
Srcin1	A	G	11: 97,534,609	S541P	probably damaging	Het
Tc2n	A	T	12: 101,665,675	F308I	probably damaging	Het
Tdrd5	T	C	1: 156,262,905	D857G	probably benign	Het
Timm22	A	G	11: 76,407,308	D35G	probably benign	Het
Tram1l1	C	A	3: 124,321,240	H16Q	probably benign	Het
Uggt1	T	C	1: 36,151,733	Y1382C	probably damaging	Het
Usp32	G	T	11: 84,988,553	D1443E	possibly damaging	Het
Uty	A	T	Y: 1,131,072	C1046S	possibly damaging	Het
Wdr31	T	A	4: 62,457,531	Q230L	probably damaging	Het
Wnt8b	C	A	19: 44,511,562	T196K	possibly damaging	Het
Xpo4	A	T	14: 57,597,979	H628Q	probably benign	Het
Zfp780b	C	T	7: 27,963,957	S391N	probably benign	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGGACTTGACCTTGGACTC -3'
(R):5'- TGTAGAGGGACAACGCCTTG -3'

Sequencing Primer
(F):5'- ACCTTGGACTCCGGGTATG -3'
(R):5'- TCGAAGCGGGTGCACTTAG -3'

Posted On

2019-10-07