Incidental Mutation 'R7469:Flt1'
ID 579022
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene Name FMS-like tyrosine kinase 1
Synonyms VEGFR-1, VEGFR1, vascular endothelial growth factor receptor-1, Flt-1, sFlt1
MMRRC Submission 045543-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7469 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 147498414-147662821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 147540379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 770 (A770E)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: A770E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: A770E

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Meta Mutation Damage Score 0.8574 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,259,014 (GRCm39) L443P probably damaging Het
Abtb2 T C 2: 103,397,292 (GRCm39) V74A probably benign Het
Adam5 A T 8: 25,305,541 (GRCm39) F66I probably benign Het
Aff1 T A 5: 103,981,413 (GRCm39) D517E probably benign Het
Agbl3 A G 6: 34,791,349 (GRCm39) K559R probably damaging Het
Aldh1l2 A C 10: 83,343,969 (GRCm39) V482G probably damaging Het
Ankra2 C T 13: 98,402,882 (GRCm39) A43V probably benign Het
Ankrd50 C A 3: 38,508,342 (GRCm39) V419F probably damaging Het
Arhgef16 G A 4: 154,375,763 (GRCm39) T77M probably damaging Het
Best3 T C 10: 116,840,290 (GRCm39) V240A probably damaging Het
Btbd7 T C 12: 102,779,027 (GRCm39) Y413C probably damaging Het
Bzw2 A T 12: 36,157,550 (GRCm39) V305E probably damaging Het
Cacng8 G A 7: 3,463,621 (GRCm39) A258T possibly damaging Het
Cfap157 T C 2: 32,670,696 (GRCm39) Y184C probably damaging Het
Chmp3 T A 6: 71,556,652 (GRCm39) V184E possibly damaging Het
Cst5 C T 2: 149,247,496 (GRCm39) L71F probably benign Het
Ctdspl2 A T 2: 121,837,362 (GRCm39) E376D possibly damaging Het
Cyfip1 A G 7: 55,527,468 (GRCm39) D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 (GRCm39) probably null Het
Cyp2c66 T A 19: 39,172,307 (GRCm39) F407L probably damaging Het
Dcp2 T C 18: 44,529,019 (GRCm39) F45L probably damaging Het
Dhx34 C T 7: 15,950,364 (GRCm39) R268H probably benign Het
Dnajc7 A T 11: 100,482,377 (GRCm39) M205K probably benign Het
Dzip3 C T 16: 48,765,242 (GRCm39) V491M probably benign Het
Farp1 T C 14: 121,512,833 (GRCm39) L777P probably damaging Het
Fchsd2 T G 7: 100,927,863 (GRCm39) probably null Het
Fer1l6 A T 15: 58,462,419 (GRCm39) probably null Het
Fhip1a T C 3: 85,580,069 (GRCm39) D712G probably benign Het
Fitm2 A G 2: 163,311,742 (GRCm39) F157S probably damaging Het
Flt3 T A 5: 147,268,084 (GRCm39) E967V probably benign Het
Foxc1 G C 13: 31,992,361 (GRCm39) A391P unknown Het
Foxc1 C T 13: 31,992,362 (GRCm39) A391V unknown Het
Gimap6 T A 6: 48,679,392 (GRCm39) T215S probably benign Het
Gm2431 A T 7: 141,811,518 (GRCm39) C129S unknown Het
Itpr3 T C 17: 27,340,028 (GRCm39) S2636P possibly damaging Het
Lsg1 A G 16: 30,380,635 (GRCm39) Y601H probably benign Het
Map4 G T 9: 109,856,865 (GRCm39) probably null Het
Mga T C 2: 119,733,527 (GRCm39) M125T probably damaging Het
Mxi1 A G 19: 53,360,091 (GRCm39) D271G probably damaging Het
Ndst3 T A 3: 123,465,310 (GRCm39) T221S possibly damaging Het
Neto1 T A 18: 86,516,813 (GRCm39) S377T probably benign Het
Nkx6-2 T C 7: 139,161,555 (GRCm39) E210G probably damaging Het
Nos2 G T 11: 78,843,797 (GRCm39) V915F possibly damaging Het
Nrros G A 16: 31,963,030 (GRCm39) A329V probably benign Het
Numb T C 12: 83,850,578 (GRCm39) K211E probably benign Het
Nup210 T A 6: 90,995,874 (GRCm39) I1671F probably benign Het
Or12j3 G A 7: 139,953,050 (GRCm39) L158F possibly damaging Het
Or4c106 T A 2: 88,682,847 (GRCm39) D184E probably benign Het
Or4c31 T A 2: 88,291,691 (GRCm39) H2Q probably benign Het
Pcdh15 A T 10: 74,481,812 (GRCm39) M386L probably benign Het
Pcdhb3 C A 18: 37,434,388 (GRCm39) T118K probably benign Het
Pcdhb8 A T 18: 37,489,011 (GRCm39) I230F probably damaging Het
Peli2 G A 14: 48,488,015 (GRCm39) V120I probably benign Het
Pramel15 T A 4: 144,099,673 (GRCm39) Q364L probably damaging Het
Pramel7 T A 2: 87,321,748 (GRCm39) M96L probably benign Het
Prex2 T A 1: 11,355,293 (GRCm39) S1531R probably damaging Het
Prpf31 A G 7: 3,636,392 (GRCm39) T138A possibly damaging Het
Psme4 C T 11: 30,752,837 (GRCm39) T175I probably benign Het
Rasgrf2 A G 13: 92,165,530 (GRCm39) probably null Het
Rps19 T A 7: 24,589,190 (GRCm39) *146K probably null Het
Rsu1 T C 2: 13,082,371 (GRCm39) N260S probably benign Het
Serpina3k T C 12: 104,311,594 (GRCm39) C391R not run Het
Sipa1l1 T G 12: 82,467,438 (GRCm39) probably null Het
Snd1 T A 6: 28,626,126 (GRCm39) Y394N probably damaging Het
Spaca4 A T 7: 45,374,831 (GRCm39) V57E probably damaging Het
Spata31d1b A G 13: 59,863,278 (GRCm39) Y142C probably benign Het
Sptbn2 A G 19: 4,795,146 (GRCm39) K1535E probably benign Het
Srcin1 A G 11: 97,425,435 (GRCm39) S541P probably damaging Het
Tc2n A T 12: 101,631,934 (GRCm39) F308I probably damaging Het
Tdrd5 T C 1: 156,090,475 (GRCm39) D857G probably benign Het
Timm22 A G 11: 76,298,134 (GRCm39) D35G probably benign Het
Tram1l1 C A 3: 124,114,889 (GRCm39) H16Q probably benign Het
Uggt1 T C 1: 36,190,814 (GRCm39) Y1382C probably damaging Het
Usp32 G T 11: 84,879,379 (GRCm39) D1443E possibly damaging Het
Uty A T Y: 1,131,072 (GRCm39) C1046S possibly damaging Het
Wdr31 T A 4: 62,375,768 (GRCm39) Q230L probably damaging Het
Wnt8b C A 19: 44,500,001 (GRCm39) T196K possibly damaging Het
Xpo4 A T 14: 57,835,436 (GRCm39) H628Q probably benign Het
Zfp780b C T 7: 27,663,382 (GRCm39) S391N probably benign Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147,517,110 (GRCm39) critical splice donor site probably null
IGL00469:Flt1 APN 5 147,540,415 (GRCm39) missense probably damaging 0.99
IGL00897:Flt1 APN 5 147,526,664 (GRCm39) missense probably benign 0.25
IGL01111:Flt1 APN 5 147,515,146 (GRCm39) missense probably damaging 1.00
IGL01154:Flt1 APN 5 147,512,966 (GRCm39) missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147,508,271 (GRCm39) missense probably benign 0.01
IGL01973:Flt1 APN 5 147,620,699 (GRCm39) missense probably benign 0.01
IGL02079:Flt1 APN 5 147,505,641 (GRCm39) splice site probably benign
IGL02143:Flt1 APN 5 147,515,246 (GRCm39) missense probably benign 0.00
IGL02156:Flt1 APN 5 147,618,551 (GRCm39) missense probably damaging 0.99
IGL02345:Flt1 APN 5 147,519,436 (GRCm39) missense probably benign 0.20
IGL02548:Flt1 APN 5 147,576,058 (GRCm39) missense probably benign 0.00
IGL02631:Flt1 APN 5 147,610,384 (GRCm39) nonsense probably null
IGL02686:Flt1 APN 5 147,525,412 (GRCm39) missense probably damaging 1.00
IGL02938:Flt1 APN 5 147,615,109 (GRCm39) missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147,618,734 (GRCm39) nonsense probably null
IGL03196:Flt1 APN 5 147,551,937 (GRCm39) critical splice donor site probably null
IGL03205:Flt1 APN 5 147,636,631 (GRCm39) missense probably benign 0.00
IGL03255:Flt1 APN 5 147,525,331 (GRCm39) splice site probably benign
flywheels UTSW 5 147,536,456 (GRCm39) missense probably damaging 1.00
BB008:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
BB018:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147,591,980 (GRCm39) missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147,615,049 (GRCm39) missense probably damaging 1.00
R0013:Flt1 UTSW 5 147,507,824 (GRCm39) splice site probably benign
R0380:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
R0448:Flt1 UTSW 5 147,503,204 (GRCm39) splice site probably benign
R0789:Flt1 UTSW 5 147,576,293 (GRCm39) missense probably damaging 1.00
R1005:Flt1 UTSW 5 147,618,695 (GRCm39) missense probably damaging 0.99
R1241:Flt1 UTSW 5 147,536,456 (GRCm39) missense probably damaging 1.00
R1302:Flt1 UTSW 5 147,501,050 (GRCm39) missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147,517,126 (GRCm39) missense probably damaging 1.00
R1615:Flt1 UTSW 5 147,576,098 (GRCm39) missense probably damaging 1.00
R1634:Flt1 UTSW 5 147,613,240 (GRCm39) missense probably damaging 1.00
R1749:Flt1 UTSW 5 147,591,929 (GRCm39) missense probably benign 0.00
R1768:Flt1 UTSW 5 147,609,519 (GRCm39) missense probably damaging 1.00
R1972:Flt1 UTSW 5 147,591,903 (GRCm39) splice site probably benign
R2074:Flt1 UTSW 5 147,536,416 (GRCm39) missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147,576,232 (GRCm39) missense probably damaging 1.00
R2864:Flt1 UTSW 5 147,531,431 (GRCm39) missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147,531,431 (GRCm39) missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147,536,403 (GRCm39) missense probably damaging 1.00
R3820:Flt1 UTSW 5 147,636,827 (GRCm39) splice site probably benign
R4089:Flt1 UTSW 5 147,501,051 (GRCm39) missense probably benign 0.03
R4299:Flt1 UTSW 5 147,620,717 (GRCm39) missense probably benign 0.00
R4570:Flt1 UTSW 5 147,531,423 (GRCm39) missense probably damaging 1.00
R4812:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4853:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4865:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4900:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4906:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4907:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R4909:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5072:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5073:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5074:Flt1 UTSW 5 147,620,749 (GRCm39) missense probably benign 0.30
R5218:Flt1 UTSW 5 147,618,738 (GRCm39) missense probably damaging 1.00
R5547:Flt1 UTSW 5 147,591,948 (GRCm39) missense probably damaging 1.00
R5731:Flt1 UTSW 5 147,614,962 (GRCm39) missense probably benign 0.16
R5732:Flt1 UTSW 5 147,571,293 (GRCm39) nonsense probably null
R5804:Flt1 UTSW 5 147,517,247 (GRCm39) splice site probably null
R6107:Flt1 UTSW 5 147,540,403 (GRCm39) missense probably benign 0.15
R6440:Flt1 UTSW 5 147,501,115 (GRCm39) missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147,620,751 (GRCm39) missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147,515,186 (GRCm39) missense probably benign 0.27
R7068:Flt1 UTSW 5 147,610,444 (GRCm39) missense probably damaging 1.00
R7112:Flt1 UTSW 5 147,540,379 (GRCm39) missense probably damaging 1.00
R7195:Flt1 UTSW 5 147,540,386 (GRCm39) missense probably damaging 1.00
R7255:Flt1 UTSW 5 147,517,216 (GRCm39) missense probably damaging 1.00
R7347:Flt1 UTSW 5 147,517,191 (GRCm39) missense probably damaging 1.00
R7473:Flt1 UTSW 5 147,531,405 (GRCm39) missense probably damaging 1.00
R7663:Flt1 UTSW 5 147,591,930 (GRCm39) missense probably benign
R7688:Flt1 UTSW 5 147,613,135 (GRCm39) missense probably benign
R7729:Flt1 UTSW 5 147,637,177 (GRCm39) missense probably benign 0.00
R7931:Flt1 UTSW 5 147,525,382 (GRCm39) missense probably damaging 1.00
R8051:Flt1 UTSW 5 147,519,501 (GRCm39) missense probably benign 0.02
R8275:Flt1 UTSW 5 147,614,957 (GRCm39) missense probably damaging 0.99
R8434:Flt1 UTSW 5 147,576,253 (GRCm39) missense probably damaging 0.97
R8442:Flt1 UTSW 5 147,512,983 (GRCm39) missense probably damaging 1.00
R8756:Flt1 UTSW 5 147,576,224 (GRCm39) missense probably benign 0.07
R8855:Flt1 UTSW 5 147,618,460 (GRCm39) missense probably damaging 1.00
R8855:Flt1 UTSW 5 147,507,682 (GRCm39) missense probably benign 0.00
R9165:Flt1 UTSW 5 147,552,047 (GRCm39) missense probably damaging 0.99
R9240:Flt1 UTSW 5 147,618,676 (GRCm39) missense probably benign
R9439:Flt1 UTSW 5 147,515,207 (GRCm39) missense probably damaging 1.00
R9658:Flt1 UTSW 5 147,525,377 (GRCm39) missense probably damaging 0.97
X0064:Flt1 UTSW 5 147,610,423 (GRCm39) missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147,618,459 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCACATTCACTTTTGCTGAAC -3'
(R):5'- TGCAAGTTCACAGCCTGTCTC -3'

Sequencing Primer
(F):5'- ACATGACTGCCCCAGTGAG -3'
(R):5'- ACAGCCTGTCTCAGAAGTCATGTG -3'
Posted On 2019-10-07