Incidental Mutation 'R7469:Flt1'
ID579022
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7469 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 147603569 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 770 (A770E)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: A770E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: A770E

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Meta Mutation Damage Score 0.8574 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,368,188 L443P probably damaging Het
Abtb2 T C 2: 103,566,947 V74A probably benign Het
Adam5 A T 8: 24,815,525 F66I probably benign Het
Aff1 T A 5: 103,833,547 D517E probably benign Het
Agbl3 A G 6: 34,814,414 K559R probably damaging Het
Aldh1l2 A C 10: 83,508,105 V482G probably damaging Het
Ankra2 C T 13: 98,266,374 A43V probably benign Het
Ankrd50 C A 3: 38,454,193 V419F probably damaging Het
Arhgef16 G A 4: 154,291,306 T77M probably damaging Het
Best3 T C 10: 117,004,385 V240A probably damaging Het
Btbd7 T C 12: 102,812,768 Y413C probably damaging Het
Bzw2 A T 12: 36,107,551 V305E probably damaging Het
Cacng8 G A 7: 3,415,105 A258T possibly damaging Het
Cfap157 T C 2: 32,780,684 Y184C probably damaging Het
Chmp3 T A 6: 71,579,668 V184E possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctdspl2 A T 2: 122,006,881 E376D possibly damaging Het
Cyfip1 A G 7: 55,877,720 D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 probably null Het
Cyp2c66 T A 19: 39,183,863 F407L probably damaging Het
Dcp2 T C 18: 44,395,952 F45L probably damaging Het
Dhx34 C T 7: 16,216,439 R268H probably benign Het
Dnajc7 A T 11: 100,591,551 M205K probably benign Het
Dzip3 C T 16: 48,944,879 V491M probably benign Het
Fam160a1 T C 3: 85,672,762 D712G probably benign Het
Farp1 T C 14: 121,275,421 L777P probably damaging Het
Fchsd2 T G 7: 101,278,656 probably null Het
Fer1l6 A T 15: 58,590,570 probably null Het
Fitm2 A G 2: 163,469,822 F157S probably damaging Het
Flt3 T A 5: 147,331,274 E967V probably benign Het
Foxc1 G C 13: 31,808,378 A391P unknown Het
Foxc1 C T 13: 31,808,379 A391V unknown Het
Gimap6 T A 6: 48,702,458 T215S probably benign Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Itpr3 T C 17: 27,121,054 S2636P possibly damaging Het
Lsg1 A G 16: 30,561,817 Y601H probably benign Het
Map4 G T 9: 110,027,797 probably null Het
Mga T C 2: 119,903,046 M125T probably damaging Het
Mxi1 A G 19: 53,371,660 D271G probably damaging Het
Ndst3 T A 3: 123,671,661 T221S possibly damaging Het
Neto1 T A 18: 86,498,688 S377T probably benign Het
Nkx6-2 T C 7: 139,581,639 E210G probably damaging Het
Nos2 G T 11: 78,952,971 V915F possibly damaging Het
Nrros G A 16: 32,144,212 A329V probably benign Het
Numb T C 12: 83,803,804 K211E probably benign Het
Nup210 T A 6: 91,018,892 I1671F probably benign Het
Olfr1183 T A 2: 88,461,347 H2Q probably benign Het
Olfr1204 T A 2: 88,852,503 D184E probably benign Het
Olfr530 G A 7: 140,373,137 L158F possibly damaging Het
Pcdh15 A T 10: 74,645,980 M386L probably benign Het
Pcdhb3 C A 18: 37,301,335 T118K probably benign Het
Pcdhb8 A T 18: 37,355,958 I230F probably damaging Het
Peli2 G A 14: 48,250,558 V120I probably benign Het
Pramef20 T A 4: 144,373,103 Q364L probably damaging Het
Pramel7 T A 2: 87,491,404 M96L probably benign Het
Prex2 T A 1: 11,285,069 S1531R probably damaging Het
Prpf31 A G 7: 3,633,393 T138A possibly damaging Het
Psme4 C T 11: 30,802,837 T175I probably benign Het
Rasgrf2 A G 13: 92,029,022 probably null Het
Rps19 T A 7: 24,889,765 *146K probably null Het
Rsu1 T C 2: 13,077,560 N260S probably benign Het
Serpina3k T C 12: 104,345,335 C391R not run Het
Sipa1l1 T G 12: 82,420,664 probably null Het
Snd1 T A 6: 28,626,127 Y394N probably damaging Het
Spaca4 A T 7: 45,725,407 V57E probably damaging Het
Spata31d1b A G 13: 59,715,464 Y142C probably benign Het
Sptbn2 A G 19: 4,745,118 K1535E probably benign Het
Srcin1 A G 11: 97,534,609 S541P probably damaging Het
Tc2n A T 12: 101,665,675 F308I probably damaging Het
Tdrd5 T C 1: 156,262,905 D857G probably benign Het
Timm22 A G 11: 76,407,308 D35G probably benign Het
Tram1l1 C A 3: 124,321,240 H16Q probably benign Het
Uggt1 T C 1: 36,151,733 Y1382C probably damaging Het
Usp32 G T 11: 84,988,553 D1443E possibly damaging Het
Uty A T Y: 1,131,072 C1046S possibly damaging Het
Wdr31 T A 4: 62,457,531 Q230L probably damaging Het
Wnt8b C A 19: 44,511,562 T196K possibly damaging Het
Xpo4 A T 14: 57,597,979 H628Q probably benign Het
Zfp780b C T 7: 27,963,957 S391N probably benign Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACCACATTCACTTTTGCTGAAC -3'
(R):5'- TGCAAGTTCACAGCCTGTCTC -3'

Sequencing Primer
(F):5'- ACATGACTGCCCCAGTGAG -3'
(R):5'- ACAGCCTGTCTCAGAAGTCATGTG -3'
Posted On2019-10-07