Mutagenetix > Incidental Mutation

Incidental Mutation 'R7469:Agbl3'

579024

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7469 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34814414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 559 (K559R)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: K559R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: K559R

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: K554R

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: K554R

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Meta Mutation Damage Score

0.2059

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (77/79)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,368,188	L443P	probably damaging	Het
Abtb2	T	C	2: 103,566,947	V74A	probably benign	Het
Adam5	A	T	8: 24,815,525	F66I	probably benign	Het
Aff1	T	A	5: 103,833,547	D517E	probably benign	Het
Aldh1l2	A	C	10: 83,508,105	V482G	probably damaging	Het
Ankra2	C	T	13: 98,266,374	A43V	probably benign	Het
Ankrd50	C	A	3: 38,454,193	V419F	probably damaging	Het
Arhgef16	G	A	4: 154,291,306	T77M	probably damaging	Het
Best3	T	C	10: 117,004,385	V240A	probably damaging	Het
Btbd7	T	C	12: 102,812,768	Y413C	probably damaging	Het
Bzw2	A	T	12: 36,107,551	V305E	probably damaging	Het
Cacng8	G	A	7: 3,415,105	A258T	possibly damaging	Het
Cfap157	T	C	2: 32,780,684	Y184C	probably damaging	Het
Chmp3	T	A	6: 71,579,668	V184E	possibly damaging	Het
Cst10	C	T	2: 149,405,576	L71F	probably benign	Het
Ctdspl2	A	T	2: 122,006,881	E376D	possibly damaging	Het
Cyfip1	A	G	7: 55,877,720	D200G	possibly damaging	Het
Cylc2	T	A	4: 51,227,970		probably null	Het
Cyp2c66	T	A	19: 39,183,863	F407L	probably damaging	Het
Dcp2	T	C	18: 44,395,952	F45L	probably damaging	Het
Dhx34	C	T	7: 16,216,439	R268H	probably benign	Het
Dnajc7	A	T	11: 100,591,551	M205K	probably benign	Het
Dzip3	C	T	16: 48,944,879	V491M	probably benign	Het
Fam160a1	T	C	3: 85,672,762	D712G	probably benign	Het
Farp1	T	C	14: 121,275,421	L777P	probably damaging	Het
Fchsd2	T	G	7: 101,278,656		probably null	Het
Fer1l6	A	T	15: 58,590,570		probably null	Het
Fitm2	A	G	2: 163,469,822	F157S	probably damaging	Het
Flt1	G	T	5: 147,603,569	A770E	probably damaging	Het
Flt3	T	A	5: 147,331,274	E967V	probably benign	Het
Foxc1	G	C	13: 31,808,378	A391P	unknown	Het
Foxc1	C	T	13: 31,808,379	A391V	unknown	Het
Gimap6	T	A	6: 48,702,458	T215S	probably benign	Het
Gm2431	A	T	7: 142,257,781	C129S	unknown	Het
Itpr3	T	C	17: 27,121,054	S2636P	possibly damaging	Het
Lsg1	A	G	16: 30,561,817	Y601H	probably benign	Het
Map4	G	T	9: 110,027,797		probably null	Het
Mga	T	C	2: 119,903,046	M125T	probably damaging	Het
Mxi1	A	G	19: 53,371,660	D271G	probably damaging	Het
Ndst3	T	A	3: 123,671,661	T221S	possibly damaging	Het
Neto1	T	A	18: 86,498,688	S377T	probably benign	Het
Nkx6-2	T	C	7: 139,581,639	E210G	probably damaging	Het
Nos2	G	T	11: 78,952,971	V915F	possibly damaging	Het
Nrros	G	A	16: 32,144,212	A329V	probably benign	Het
Numb	T	C	12: 83,803,804	K211E	probably benign	Het
Nup210	T	A	6: 91,018,892	I1671F	probably benign	Het
Olfr1183	T	A	2: 88,461,347	H2Q	probably benign	Het
Olfr1204	T	A	2: 88,852,503	D184E	probably benign	Het
Olfr530	G	A	7: 140,373,137	L158F	possibly damaging	Het
Pcdh15	A	T	10: 74,645,980	M386L	probably benign	Het
Pcdhb3	C	A	18: 37,301,335	T118K	probably benign	Het
Pcdhb8	A	T	18: 37,355,958	I230F	probably damaging	Het
Peli2	G	A	14: 48,250,558	V120I	probably benign	Het
Pramef20	T	A	4: 144,373,103	Q364L	probably damaging	Het
Pramel7	T	A	2: 87,491,404	M96L	probably benign	Het
Prex2	T	A	1: 11,285,069	S1531R	probably damaging	Het
Prpf31	A	G	7: 3,633,393	T138A	possibly damaging	Het
Psme4	C	T	11: 30,802,837	T175I	probably benign	Het
Rasgrf2	A	G	13: 92,029,022		probably null	Het
Rps19	T	A	7: 24,889,765	*146K	probably null	Het
Rsu1	T	C	2: 13,077,560	N260S	probably benign	Het
Serpina3k	T	C	12: 104,345,335	C391R	not run	Het
Sipa1l1	T	G	12: 82,420,664		probably null	Het
Snd1	T	A	6: 28,626,127	Y394N	probably damaging	Het
Spaca4	A	T	7: 45,725,407	V57E	probably damaging	Het
Spata31d1b	A	G	13: 59,715,464	Y142C	probably benign	Het
Sptbn2	A	G	19: 4,745,118	K1535E	probably benign	Het
Srcin1	A	G	11: 97,534,609	S541P	probably damaging	Het
Tc2n	A	T	12: 101,665,675	F308I	probably damaging	Het
Tdrd5	T	C	1: 156,262,905	D857G	probably benign	Het
Timm22	A	G	11: 76,407,308	D35G	probably benign	Het
Tram1l1	C	A	3: 124,321,240	H16Q	probably benign	Het
Uggt1	T	C	1: 36,151,733	Y1382C	probably damaging	Het
Usp32	G	T	11: 84,988,553	D1443E	possibly damaging	Het
Uty	A	T	Y: 1,131,072	C1046S	possibly damaging	Het
Wdr31	T	A	4: 62,457,531	Q230L	probably damaging	Het
Wnt8b	C	A	19: 44,511,562	T196K	possibly damaging	Het
Xpo4	A	T	14: 57,597,979	H628Q	probably benign	Het
Zfp780b	C	T	7: 27,963,957	S391N	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCCCCGAGAAGAAATGAGC -3'
(R):5'- GGGTGATTACTACATACACCCAAAC -3'

Sequencing Primer
(F):5'- TTAACCTATTAACTGACCTACTCCAG -3'
(R):5'- TACACCCAAACTCAGAAAACCATTAG -3'

Posted On

2019-10-07