Incidental Mutation 'R7469:Nos2'
ID 579045
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7469 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 78952971 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 915 (V915F)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: V915F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: V915F

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: V802F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,368,188 L443P probably damaging Het
Abtb2 T C 2: 103,566,947 V74A probably benign Het
Adam5 A T 8: 24,815,525 F66I probably benign Het
Aff1 T A 5: 103,833,547 D517E probably benign Het
Agbl3 A G 6: 34,814,414 K559R probably damaging Het
Aldh1l2 A C 10: 83,508,105 V482G probably damaging Het
Ankra2 C T 13: 98,266,374 A43V probably benign Het
Ankrd50 C A 3: 38,454,193 V419F probably damaging Het
Arhgef16 G A 4: 154,291,306 T77M probably damaging Het
Best3 T C 10: 117,004,385 V240A probably damaging Het
Btbd7 T C 12: 102,812,768 Y413C probably damaging Het
Bzw2 A T 12: 36,107,551 V305E probably damaging Het
Cacng8 G A 7: 3,415,105 A258T possibly damaging Het
Cfap157 T C 2: 32,780,684 Y184C probably damaging Het
Chmp3 T A 6: 71,579,668 V184E possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctdspl2 A T 2: 122,006,881 E376D possibly damaging Het
Cyfip1 A G 7: 55,877,720 D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 probably null Het
Cyp2c66 T A 19: 39,183,863 F407L probably damaging Het
Dcp2 T C 18: 44,395,952 F45L probably damaging Het
Dhx34 C T 7: 16,216,439 R268H probably benign Het
Dnajc7 A T 11: 100,591,551 M205K probably benign Het
Dzip3 C T 16: 48,944,879 V491M probably benign Het
Fam160a1 T C 3: 85,672,762 D712G probably benign Het
Farp1 T C 14: 121,275,421 L777P probably damaging Het
Fchsd2 T G 7: 101,278,656 probably null Het
Fer1l6 A T 15: 58,590,570 probably null Het
Fitm2 A G 2: 163,469,822 F157S probably damaging Het
Flt1 G T 5: 147,603,569 A770E probably damaging Het
Flt3 T A 5: 147,331,274 E967V probably benign Het
Foxc1 G C 13: 31,808,378 A391P unknown Het
Foxc1 C T 13: 31,808,379 A391V unknown Het
Gimap6 T A 6: 48,702,458 T215S probably benign Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Itpr3 T C 17: 27,121,054 S2636P possibly damaging Het
Lsg1 A G 16: 30,561,817 Y601H probably benign Het
Map4 G T 9: 110,027,797 probably null Het
Mga T C 2: 119,903,046 M125T probably damaging Het
Mxi1 A G 19: 53,371,660 D271G probably damaging Het
Ndst3 T A 3: 123,671,661 T221S possibly damaging Het
Neto1 T A 18: 86,498,688 S377T probably benign Het
Nkx6-2 T C 7: 139,581,639 E210G probably damaging Het
Nrros G A 16: 32,144,212 A329V probably benign Het
Numb T C 12: 83,803,804 K211E probably benign Het
Nup210 T A 6: 91,018,892 I1671F probably benign Het
Olfr1183 T A 2: 88,461,347 H2Q probably benign Het
Olfr1204 T A 2: 88,852,503 D184E probably benign Het
Olfr530 G A 7: 140,373,137 L158F possibly damaging Het
Pcdh15 A T 10: 74,645,980 M386L probably benign Het
Pcdhb3 C A 18: 37,301,335 T118K probably benign Het
Pcdhb8 A T 18: 37,355,958 I230F probably damaging Het
Peli2 G A 14: 48,250,558 V120I probably benign Het
Pramef20 T A 4: 144,373,103 Q364L probably damaging Het
Pramel7 T A 2: 87,491,404 M96L probably benign Het
Prex2 T A 1: 11,285,069 S1531R probably damaging Het
Prpf31 A G 7: 3,633,393 T138A possibly damaging Het
Psme4 C T 11: 30,802,837 T175I probably benign Het
Rasgrf2 A G 13: 92,029,022 probably null Het
Rps19 T A 7: 24,889,765 *146K probably null Het
Rsu1 T C 2: 13,077,560 N260S probably benign Het
Serpina3k T C 12: 104,345,335 C391R not run Het
Sipa1l1 T G 12: 82,420,664 probably null Het
Snd1 T A 6: 28,626,127 Y394N probably damaging Het
Spaca4 A T 7: 45,725,407 V57E probably damaging Het
Spata31d1b A G 13: 59,715,464 Y142C probably benign Het
Sptbn2 A G 19: 4,745,118 K1535E probably benign Het
Srcin1 A G 11: 97,534,609 S541P probably damaging Het
Tc2n A T 12: 101,665,675 F308I probably damaging Het
Tdrd5 T C 1: 156,262,905 D857G probably benign Het
Timm22 A G 11: 76,407,308 D35G probably benign Het
Tram1l1 C A 3: 124,321,240 H16Q probably benign Het
Uggt1 T C 1: 36,151,733 Y1382C probably damaging Het
Usp32 G T 11: 84,988,553 D1443E possibly damaging Het
Uty A T Y: 1,131,072 C1046S possibly damaging Het
Wdr31 T A 4: 62,457,531 Q230L probably damaging Het
Wnt8b C A 19: 44,511,562 T196K possibly damaging Het
Xpo4 A T 14: 57,597,979 H628Q probably benign Het
Zfp780b C T 7: 27,963,957 S391N probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTCAGAGTACAATGACTGG -3'
(R):5'- CCCCAAGGTATTGAACAGCTG -3'

Sequencing Primer
(F):5'- CCTCAGAGTACAATGACTGGAAGTTC -3'
(R):5'- CAATAAGCAACGTTCCTCTGTGG -3'
Posted On 2019-10-07