Incidental Mutation 'R7469:Nos2'
ID 579045
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission 045543-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7469 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 78843797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 915 (V915F)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: V915F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: V915F

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: V802F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,259,014 (GRCm39) L443P probably damaging Het
Abtb2 T C 2: 103,397,292 (GRCm39) V74A probably benign Het
Adam5 A T 8: 25,305,541 (GRCm39) F66I probably benign Het
Aff1 T A 5: 103,981,413 (GRCm39) D517E probably benign Het
Agbl3 A G 6: 34,791,349 (GRCm39) K559R probably damaging Het
Aldh1l2 A C 10: 83,343,969 (GRCm39) V482G probably damaging Het
Ankra2 C T 13: 98,402,882 (GRCm39) A43V probably benign Het
Ankrd50 C A 3: 38,508,342 (GRCm39) V419F probably damaging Het
Arhgef16 G A 4: 154,375,763 (GRCm39) T77M probably damaging Het
Best3 T C 10: 116,840,290 (GRCm39) V240A probably damaging Het
Btbd7 T C 12: 102,779,027 (GRCm39) Y413C probably damaging Het
Bzw2 A T 12: 36,157,550 (GRCm39) V305E probably damaging Het
Cacng8 G A 7: 3,463,621 (GRCm39) A258T possibly damaging Het
Cfap157 T C 2: 32,670,696 (GRCm39) Y184C probably damaging Het
Chmp3 T A 6: 71,556,652 (GRCm39) V184E possibly damaging Het
Cst5 C T 2: 149,247,496 (GRCm39) L71F probably benign Het
Ctdspl2 A T 2: 121,837,362 (GRCm39) E376D possibly damaging Het
Cyfip1 A G 7: 55,527,468 (GRCm39) D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 (GRCm39) probably null Het
Cyp2c66 T A 19: 39,172,307 (GRCm39) F407L probably damaging Het
Dcp2 T C 18: 44,529,019 (GRCm39) F45L probably damaging Het
Dhx34 C T 7: 15,950,364 (GRCm39) R268H probably benign Het
Dnajc7 A T 11: 100,482,377 (GRCm39) M205K probably benign Het
Dzip3 C T 16: 48,765,242 (GRCm39) V491M probably benign Het
Farp1 T C 14: 121,512,833 (GRCm39) L777P probably damaging Het
Fchsd2 T G 7: 100,927,863 (GRCm39) probably null Het
Fer1l6 A T 15: 58,462,419 (GRCm39) probably null Het
Fhip1a T C 3: 85,580,069 (GRCm39) D712G probably benign Het
Fitm2 A G 2: 163,311,742 (GRCm39) F157S probably damaging Het
Flt1 G T 5: 147,540,379 (GRCm39) A770E probably damaging Het
Flt3 T A 5: 147,268,084 (GRCm39) E967V probably benign Het
Foxc1 G C 13: 31,992,361 (GRCm39) A391P unknown Het
Foxc1 C T 13: 31,992,362 (GRCm39) A391V unknown Het
Gimap6 T A 6: 48,679,392 (GRCm39) T215S probably benign Het
Gm2431 A T 7: 141,811,518 (GRCm39) C129S unknown Het
Itpr3 T C 17: 27,340,028 (GRCm39) S2636P possibly damaging Het
Lsg1 A G 16: 30,380,635 (GRCm39) Y601H probably benign Het
Map4 G T 9: 109,856,865 (GRCm39) probably null Het
Mga T C 2: 119,733,527 (GRCm39) M125T probably damaging Het
Mxi1 A G 19: 53,360,091 (GRCm39) D271G probably damaging Het
Ndst3 T A 3: 123,465,310 (GRCm39) T221S possibly damaging Het
Neto1 T A 18: 86,516,813 (GRCm39) S377T probably benign Het
Nkx6-2 T C 7: 139,161,555 (GRCm39) E210G probably damaging Het
Nrros G A 16: 31,963,030 (GRCm39) A329V probably benign Het
Numb T C 12: 83,850,578 (GRCm39) K211E probably benign Het
Nup210 T A 6: 90,995,874 (GRCm39) I1671F probably benign Het
Or12j3 G A 7: 139,953,050 (GRCm39) L158F possibly damaging Het
Or4c106 T A 2: 88,682,847 (GRCm39) D184E probably benign Het
Or4c31 T A 2: 88,291,691 (GRCm39) H2Q probably benign Het
Pcdh15 A T 10: 74,481,812 (GRCm39) M386L probably benign Het
Pcdhb3 C A 18: 37,434,388 (GRCm39) T118K probably benign Het
Pcdhb8 A T 18: 37,489,011 (GRCm39) I230F probably damaging Het
Peli2 G A 14: 48,488,015 (GRCm39) V120I probably benign Het
Pramel15 T A 4: 144,099,673 (GRCm39) Q364L probably damaging Het
Pramel7 T A 2: 87,321,748 (GRCm39) M96L probably benign Het
Prex2 T A 1: 11,355,293 (GRCm39) S1531R probably damaging Het
Prpf31 A G 7: 3,636,392 (GRCm39) T138A possibly damaging Het
Psme4 C T 11: 30,752,837 (GRCm39) T175I probably benign Het
Rasgrf2 A G 13: 92,165,530 (GRCm39) probably null Het
Rps19 T A 7: 24,589,190 (GRCm39) *146K probably null Het
Rsu1 T C 2: 13,082,371 (GRCm39) N260S probably benign Het
Serpina3k T C 12: 104,311,594 (GRCm39) C391R not run Het
Sipa1l1 T G 12: 82,467,438 (GRCm39) probably null Het
Snd1 T A 6: 28,626,126 (GRCm39) Y394N probably damaging Het
Spaca4 A T 7: 45,374,831 (GRCm39) V57E probably damaging Het
Spata31d1b A G 13: 59,863,278 (GRCm39) Y142C probably benign Het
Sptbn2 A G 19: 4,795,146 (GRCm39) K1535E probably benign Het
Srcin1 A G 11: 97,425,435 (GRCm39) S541P probably damaging Het
Tc2n A T 12: 101,631,934 (GRCm39) F308I probably damaging Het
Tdrd5 T C 1: 156,090,475 (GRCm39) D857G probably benign Het
Timm22 A G 11: 76,298,134 (GRCm39) D35G probably benign Het
Tram1l1 C A 3: 124,114,889 (GRCm39) H16Q probably benign Het
Uggt1 T C 1: 36,190,814 (GRCm39) Y1382C probably damaging Het
Usp32 G T 11: 84,879,379 (GRCm39) D1443E possibly damaging Het
Uty A T Y: 1,131,072 (GRCm39) C1046S possibly damaging Het
Wdr31 T A 4: 62,375,768 (GRCm39) Q230L probably damaging Het
Wnt8b C A 19: 44,500,001 (GRCm39) T196K possibly damaging Het
Xpo4 A T 14: 57,835,436 (GRCm39) H628Q probably benign Het
Zfp780b C T 7: 27,663,382 (GRCm39) S391N probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78,836,553 (GRCm39) missense probably damaging 1.00
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78,819,456 (GRCm39) missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78,836,092 (GRCm39) missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R6917:Nos2 UTSW 11 78,842,053 (GRCm39) missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9433:Nos2 UTSW 11 78,850,490 (GRCm39) missense probably damaging 1.00
R9580:Nos2 UTSW 11 78,828,457 (GRCm39) missense probably benign 0.01
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTCAGAGTACAATGACTGG -3'
(R):5'- CCCCAAGGTATTGAACAGCTG -3'

Sequencing Primer
(F):5'- CCTCAGAGTACAATGACTGGAAGTTC -3'
(R):5'- CAATAAGCAACGTTCCTCTGTGG -3'
Posted On 2019-10-07