Mutagenetix > Incidental Mutation

Incidental Mutation 'R7469:Usp32'

579046

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

045543-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7469 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 84988553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1443 (D1443E)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

AlphaFold

F8VPZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108075
AA Change: D1443E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: D1443E

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

Meta Mutation Damage Score

0.1781

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (77/79)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,368,188	L443P	probably damaging	Het
Abtb2	T	C	2: 103,566,947	V74A	probably benign	Het
Adam5	A	T	8: 24,815,525	F66I	probably benign	Het
Aff1	T	A	5: 103,833,547	D517E	probably benign	Het
Agbl3	A	G	6: 34,814,414	K559R	probably damaging	Het
Aldh1l2	A	C	10: 83,508,105	V482G	probably damaging	Het
Ankra2	C	T	13: 98,266,374	A43V	probably benign	Het
Ankrd50	C	A	3: 38,454,193	V419F	probably damaging	Het
Arhgef16	G	A	4: 154,291,306	T77M	probably damaging	Het
Best3	T	C	10: 117,004,385	V240A	probably damaging	Het
Btbd7	T	C	12: 102,812,768	Y413C	probably damaging	Het
Bzw2	A	T	12: 36,107,551	V305E	probably damaging	Het
Cacng8	G	A	7: 3,415,105	A258T	possibly damaging	Het
Cfap157	T	C	2: 32,780,684	Y184C	probably damaging	Het
Chmp3	T	A	6: 71,579,668	V184E	possibly damaging	Het
Cst10	C	T	2: 149,405,576	L71F	probably benign	Het
Ctdspl2	A	T	2: 122,006,881	E376D	possibly damaging	Het
Cyfip1	A	G	7: 55,877,720	D200G	possibly damaging	Het
Cylc2	T	A	4: 51,227,970		probably null	Het
Cyp2c66	T	A	19: 39,183,863	F407L	probably damaging	Het
Dcp2	T	C	18: 44,395,952	F45L	probably damaging	Het
Dhx34	C	T	7: 16,216,439	R268H	probably benign	Het
Dnajc7	A	T	11: 100,591,551	M205K	probably benign	Het
Dzip3	C	T	16: 48,944,879	V491M	probably benign	Het
Fam160a1	T	C	3: 85,672,762	D712G	probably benign	Het
Farp1	T	C	14: 121,275,421	L777P	probably damaging	Het
Fchsd2	T	G	7: 101,278,656		probably null	Het
Fer1l6	A	T	15: 58,590,570		probably null	Het
Fitm2	A	G	2: 163,469,822	F157S	probably damaging	Het
Flt1	G	T	5: 147,603,569	A770E	probably damaging	Het
Flt3	T	A	5: 147,331,274	E967V	probably benign	Het
Foxc1	G	C	13: 31,808,378	A391P	unknown	Het
Foxc1	C	T	13: 31,808,379	A391V	unknown	Het
Gimap6	T	A	6: 48,702,458	T215S	probably benign	Het
Gm2431	A	T	7: 142,257,781	C129S	unknown	Het
Itpr3	T	C	17: 27,121,054	S2636P	possibly damaging	Het
Lsg1	A	G	16: 30,561,817	Y601H	probably benign	Het
Map4	G	T	9: 110,027,797		probably null	Het
Mga	T	C	2: 119,903,046	M125T	probably damaging	Het
Mxi1	A	G	19: 53,371,660	D271G	probably damaging	Het
Ndst3	T	A	3: 123,671,661	T221S	possibly damaging	Het
Neto1	T	A	18: 86,498,688	S377T	probably benign	Het
Nkx6-2	T	C	7: 139,581,639	E210G	probably damaging	Het
Nos2	G	T	11: 78,952,971	V915F	possibly damaging	Het
Nrros	G	A	16: 32,144,212	A329V	probably benign	Het
Numb	T	C	12: 83,803,804	K211E	probably benign	Het
Nup210	T	A	6: 91,018,892	I1671F	probably benign	Het
Olfr1183	T	A	2: 88,461,347	H2Q	probably benign	Het
Olfr1204	T	A	2: 88,852,503	D184E	probably benign	Het
Olfr530	G	A	7: 140,373,137	L158F	possibly damaging	Het
Pcdh15	A	T	10: 74,645,980	M386L	probably benign	Het
Pcdhb3	C	A	18: 37,301,335	T118K	probably benign	Het
Pcdhb8	A	T	18: 37,355,958	I230F	probably damaging	Het
Peli2	G	A	14: 48,250,558	V120I	probably benign	Het
Pramef20	T	A	4: 144,373,103	Q364L	probably damaging	Het
Pramel7	T	A	2: 87,491,404	M96L	probably benign	Het
Prex2	T	A	1: 11,285,069	S1531R	probably damaging	Het
Prpf31	A	G	7: 3,633,393	T138A	possibly damaging	Het
Psme4	C	T	11: 30,802,837	T175I	probably benign	Het
Rasgrf2	A	G	13: 92,029,022		probably null	Het
Rps19	T	A	7: 24,889,765	*146K	probably null	Het
Rsu1	T	C	2: 13,077,560	N260S	probably benign	Het
Serpina3k	T	C	12: 104,345,335	C391R	not run	Het
Sipa1l1	T	G	12: 82,420,664		probably null	Het
Snd1	T	A	6: 28,626,127	Y394N	probably damaging	Het
Spaca4	A	T	7: 45,725,407	V57E	probably damaging	Het
Spata31d1b	A	G	13: 59,715,464	Y142C	probably benign	Het
Sptbn2	A	G	19: 4,745,118	K1535E	probably benign	Het
Srcin1	A	G	11: 97,534,609	S541P	probably damaging	Het
Tc2n	A	T	12: 101,665,675	F308I	probably damaging	Het
Tdrd5	T	C	1: 156,262,905	D857G	probably benign	Het
Timm22	A	G	11: 76,407,308	D35G	probably benign	Het
Tram1l1	C	A	3: 124,321,240	H16Q	probably benign	Het
Uggt1	T	C	1: 36,151,733	Y1382C	probably damaging	Het
Uty	A	T	Y: 1,131,072	C1046S	possibly damaging	Het
Wdr31	T	A	4: 62,457,531	Q230L	probably damaging	Het
Wnt8b	C	A	19: 44,511,562	T196K	possibly damaging	Het
Xpo4	A	T	14: 57,597,979	H628Q	probably benign	Het
Zfp780b	C	T	7: 27,963,957	S391N	probably benign	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
R8924:Usp32	UTSW	11	85025544	missense	probably damaging	0.98
R9002:Usp32	UTSW	11	85053951	missense	probably damaging	0.96
R9145:Usp32	UTSW	11	85022292	missense	probably damaging	1.00
R9209:Usp32	UTSW	11	85040012	missense	probably damaging	0.98
R9211:Usp32	UTSW	11	85022733	missense	probably damaging	1.00
R9296:Usp32	UTSW	11	85017652	missense	probably damaging	1.00
R9310:Usp32	UTSW	11	85051202	missense	probably benign	0.29
R9417:Usp32	UTSW	11	84994543	missense	probably damaging	1.00
R9514:Usp32	UTSW	11	85022734	missense	probably damaging	0.99
R9652:Usp32	UTSW	11	85030491	missense	probably damaging	0.97
R9723:Usp32	UTSW	11	85044710	nonsense	probably null
R9757:Usp32	UTSW	11	85077329	nonsense	probably null
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTCATCAGTGCTGTCTTC -3'
(R):5'- GGCATTTGGACTTAACAATTCTCCC -3'

Sequencing Primer
(F):5'- CTTCACTATGGTTTCCAAGCTGAC -3'
(R):5'- AAAAGTGGAGCCAGCTGTCCC -3'

Posted On

2019-10-07