Incidental Mutation 'R7469:Dnajc7'
ID 579049
Institutional Source Beutler Lab
Gene Symbol Dnajc7
Ensembl Gene ENSMUSG00000014195
Gene Name DnaJ heat shock protein family (Hsp40) member C7
Synonyms mTpr2, Ttc2, 2010003F24Rik, mDj11, 2010004G07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_019795; MGI: 1928373

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7469 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 100582818-100620168 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100591551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 205 (M205K)
Ref Sequence ENSEMBL: ENSMUSP00000014339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000146840]
AlphaFold Q9QYI3
Predicted Effect probably benign
Transcript: ENSMUST00000014339
AA Change: M205K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195
AA Change: M205K

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146840
SMART Domains Protein: ENSMUSP00000115438
Gene: ENSMUSG00000014195

DomainStartEndE-ValueType
TPR 12 45 3.39e-7 SMART
TPR 46 79 1.11e-2 SMART
TPR 80 113 4.09e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116793
Gene: ENSMUSG00000014195
AA Change: M157K

DomainStartEndE-ValueType
TPR 19 52 3.39e-7 SMART
TPR 53 86 1.11e-2 SMART
Blast:TPR 95 128 1e-13 BLAST
Blast:TPR 129 162 3e-14 BLAST
TPR 163 196 2.29e-4 SMART
TPR 209 242 1.11e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit hepatic steatosis and increased serum cholesterol. [provided by MGI curators]
Allele List at MGI

All alleles(178) : Targeted, other(2) Gene trapped(176)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,368,188 L443P probably damaging Het
Abtb2 T C 2: 103,566,947 V74A probably benign Het
Adam5 A T 8: 24,815,525 F66I probably benign Het
Aff1 T A 5: 103,833,547 D517E probably benign Het
Agbl3 A G 6: 34,814,414 K559R probably damaging Het
Aldh1l2 A C 10: 83,508,105 V482G probably damaging Het
Ankra2 C T 13: 98,266,374 A43V probably benign Het
Ankrd50 C A 3: 38,454,193 V419F probably damaging Het
Arhgef16 G A 4: 154,291,306 T77M probably damaging Het
Best3 T C 10: 117,004,385 V240A probably damaging Het
Btbd7 T C 12: 102,812,768 Y413C probably damaging Het
Bzw2 A T 12: 36,107,551 V305E probably damaging Het
Cacng8 G A 7: 3,415,105 A258T possibly damaging Het
Cfap157 T C 2: 32,780,684 Y184C probably damaging Het
Chmp3 T A 6: 71,579,668 V184E possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctdspl2 A T 2: 122,006,881 E376D possibly damaging Het
Cyfip1 A G 7: 55,877,720 D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 probably null Het
Cyp2c66 T A 19: 39,183,863 F407L probably damaging Het
Dcp2 T C 18: 44,395,952 F45L probably damaging Het
Dhx34 C T 7: 16,216,439 R268H probably benign Het
Dzip3 C T 16: 48,944,879 V491M probably benign Het
Fam160a1 T C 3: 85,672,762 D712G probably benign Het
Farp1 T C 14: 121,275,421 L777P probably damaging Het
Fchsd2 T G 7: 101,278,656 probably null Het
Fer1l6 A T 15: 58,590,570 probably null Het
Fitm2 A G 2: 163,469,822 F157S probably damaging Het
Flt1 G T 5: 147,603,569 A770E probably damaging Het
Flt3 T A 5: 147,331,274 E967V probably benign Het
Foxc1 G C 13: 31,808,378 A391P unknown Het
Foxc1 C T 13: 31,808,379 A391V unknown Het
Gimap6 T A 6: 48,702,458 T215S probably benign Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Itpr3 T C 17: 27,121,054 S2636P possibly damaging Het
Lsg1 A G 16: 30,561,817 Y601H probably benign Het
Map4 G T 9: 110,027,797 probably null Het
Mga T C 2: 119,903,046 M125T probably damaging Het
Mxi1 A G 19: 53,371,660 D271G probably damaging Het
Ndst3 T A 3: 123,671,661 T221S possibly damaging Het
Neto1 T A 18: 86,498,688 S377T probably benign Het
Nkx6-2 T C 7: 139,581,639 E210G probably damaging Het
Nos2 G T 11: 78,952,971 V915F possibly damaging Het
Nrros G A 16: 32,144,212 A329V probably benign Het
Numb T C 12: 83,803,804 K211E probably benign Het
Nup210 T A 6: 91,018,892 I1671F probably benign Het
Olfr1183 T A 2: 88,461,347 H2Q probably benign Het
Olfr1204 T A 2: 88,852,503 D184E probably benign Het
Olfr530 G A 7: 140,373,137 L158F possibly damaging Het
Pcdh15 A T 10: 74,645,980 M386L probably benign Het
Pcdhb3 C A 18: 37,301,335 T118K probably benign Het
Pcdhb8 A T 18: 37,355,958 I230F probably damaging Het
Peli2 G A 14: 48,250,558 V120I probably benign Het
Pramef20 T A 4: 144,373,103 Q364L probably damaging Het
Pramel7 T A 2: 87,491,404 M96L probably benign Het
Prex2 T A 1: 11,285,069 S1531R probably damaging Het
Prpf31 A G 7: 3,633,393 T138A possibly damaging Het
Psme4 C T 11: 30,802,837 T175I probably benign Het
Rasgrf2 A G 13: 92,029,022 probably null Het
Rps19 T A 7: 24,889,765 *146K probably null Het
Rsu1 T C 2: 13,077,560 N260S probably benign Het
Serpina3k T C 12: 104,345,335 C391R not run Het
Sipa1l1 T G 12: 82,420,664 probably null Het
Snd1 T A 6: 28,626,127 Y394N probably damaging Het
Spaca4 A T 7: 45,725,407 V57E probably damaging Het
Spata31d1b A G 13: 59,715,464 Y142C probably benign Het
Sptbn2 A G 19: 4,745,118 K1535E probably benign Het
Srcin1 A G 11: 97,534,609 S541P probably damaging Het
Tc2n A T 12: 101,665,675 F308I probably damaging Het
Tdrd5 T C 1: 156,262,905 D857G probably benign Het
Timm22 A G 11: 76,407,308 D35G probably benign Het
Tram1l1 C A 3: 124,321,240 H16Q probably benign Het
Uggt1 T C 1: 36,151,733 Y1382C probably damaging Het
Usp32 G T 11: 84,988,553 D1443E possibly damaging Het
Uty A T Y: 1,131,072 C1046S possibly damaging Het
Wdr31 T A 4: 62,457,531 Q230L probably damaging Het
Wnt8b C A 19: 44,511,562 T196K possibly damaging Het
Xpo4 A T 14: 57,597,979 H628Q probably benign Het
Zfp780b C T 7: 27,963,957 S391N probably benign Het
Other mutations in Dnajc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Dnajc7 APN 11 100599191 missense possibly damaging 0.90
IGL00924:Dnajc7 APN 11 100584285 missense possibly damaging 0.81
3-1:Dnajc7 UTSW 11 100589957 missense probably damaging 1.00
BB010:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
BB020:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
R1282:Dnajc7 UTSW 11 100584641 missense probably damaging 1.00
R1587:Dnajc7 UTSW 11 100601730 missense probably damaging 1.00
R1874:Dnajc7 UTSW 11 100599313 splice site probably benign
R1985:Dnajc7 UTSW 11 100590892 missense probably benign 0.11
R4020:Dnajc7 UTSW 11 100591466 missense probably damaging 0.96
R4065:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4067:Dnajc7 UTSW 11 100601781 missense probably benign 0.00
R4611:Dnajc7 UTSW 11 100590977 nonsense probably null
R4687:Dnajc7 UTSW 11 100599300 missense probably damaging 1.00
R4716:Dnajc7 UTSW 11 100619576 missense probably benign
R7740:Dnajc7 UTSW 11 100591561 missense probably benign 0.01
R7842:Dnajc7 UTSW 11 100598718 missense probably benign 0.42
R7886:Dnajc7 UTSW 11 100601803 missense probably benign 0.00
R7933:Dnajc7 UTSW 11 100596212 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGAACACCAGGCTTAG -3'
(R):5'- CACAAGGAATGTATTGGGCTGG -3'

Sequencing Primer
(F):5'- GGCTTAGAACTTACTCTACAAGCG -3'
(R):5'- GGGTTTAATCCTCAACACTGCTAGG -3'
Posted On 2019-10-07