Incidental Mutation 'R7469:Itpr3'
ID579067
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7469 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27121054 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2636 (S2636P)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025045] [ENSMUST00000049308] [ENSMUST00000118613] [ENSMUST00000119227]
PDB Structure
Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025045
Predicted Effect possibly damaging
Transcript: ENSMUST00000049308
AA Change: S2636P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: S2636P

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118613
Predicted Effect probably benign
Transcript: ENSMUST00000119227
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,368,188 L443P probably damaging Het
Abtb2 T C 2: 103,566,947 V74A probably benign Het
Adam5 A T 8: 24,815,525 F66I probably benign Het
Aff1 T A 5: 103,833,547 D517E probably benign Het
Agbl3 A G 6: 34,814,414 K559R probably damaging Het
Aldh1l2 A C 10: 83,508,105 V482G probably damaging Het
Ankra2 C T 13: 98,266,374 A43V probably benign Het
Ankrd50 C A 3: 38,454,193 V419F probably damaging Het
Arhgef16 G A 4: 154,291,306 T77M probably damaging Het
Best3 T C 10: 117,004,385 V240A probably damaging Het
Btbd7 T C 12: 102,812,768 Y413C probably damaging Het
Bzw2 A T 12: 36,107,551 V305E probably damaging Het
Cacng8 G A 7: 3,415,105 A258T possibly damaging Het
Cfap157 T C 2: 32,780,684 Y184C probably damaging Het
Chmp3 T A 6: 71,579,668 V184E possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctdspl2 A T 2: 122,006,881 E376D possibly damaging Het
Cyfip1 A G 7: 55,877,720 D200G possibly damaging Het
Cylc2 T A 4: 51,227,970 probably null Het
Cyp2c66 T A 19: 39,183,863 F407L probably damaging Het
Dcp2 T C 18: 44,395,952 F45L probably damaging Het
Dhx34 C T 7: 16,216,439 R268H probably benign Het
Dnajc7 A T 11: 100,591,551 M205K probably benign Het
Dzip3 C T 16: 48,944,879 V491M probably benign Het
Fam160a1 T C 3: 85,672,762 D712G probably benign Het
Farp1 T C 14: 121,275,421 L777P probably damaging Het
Fchsd2 T G 7: 101,278,656 probably null Het
Fer1l6 A T 15: 58,590,570 probably null Het
Fitm2 A G 2: 163,469,822 F157S probably damaging Het
Flt1 G T 5: 147,603,569 A770E probably damaging Het
Flt3 T A 5: 147,331,274 E967V probably benign Het
Foxc1 G C 13: 31,808,378 A391P unknown Het
Foxc1 C T 13: 31,808,379 A391V unknown Het
Gimap6 T A 6: 48,702,458 T215S probably benign Het
Gm2431 A T 7: 142,257,781 C129S unknown Het
Lsg1 A G 16: 30,561,817 Y601H probably benign Het
Map4 G T 9: 110,027,797 probably null Het
Mga T C 2: 119,903,046 M125T probably damaging Het
Mxi1 A G 19: 53,371,660 D271G probably damaging Het
Ndst3 T A 3: 123,671,661 T221S possibly damaging Het
Neto1 T A 18: 86,498,688 S377T probably benign Het
Nkx6-2 T C 7: 139,581,639 E210G probably damaging Het
Nos2 G T 11: 78,952,971 V915F possibly damaging Het
Nrros G A 16: 32,144,212 A329V probably benign Het
Numb T C 12: 83,803,804 K211E probably benign Het
Nup210 T A 6: 91,018,892 I1671F probably benign Het
Olfr1183 T A 2: 88,461,347 H2Q probably benign Het
Olfr1204 T A 2: 88,852,503 D184E probably benign Het
Olfr530 G A 7: 140,373,137 L158F possibly damaging Het
Pcdh15 A T 10: 74,645,980 M386L probably benign Het
Pcdhb3 C A 18: 37,301,335 T118K probably benign Het
Pcdhb8 A T 18: 37,355,958 I230F probably damaging Het
Peli2 G A 14: 48,250,558 V120I probably benign Het
Pramef20 T A 4: 144,373,103 Q364L probably damaging Het
Pramel7 T A 2: 87,491,404 M96L probably benign Het
Prex2 T A 1: 11,285,069 S1531R probably damaging Het
Prpf31 A G 7: 3,633,393 T138A possibly damaging Het
Psme4 C T 11: 30,802,837 T175I probably benign Het
Rasgrf2 A G 13: 92,029,022 probably null Het
Rps19 T A 7: 24,889,765 *146K probably null Het
Rsu1 T C 2: 13,077,560 N260S probably benign Het
Serpina3k T C 12: 104,345,335 C391R not run Het
Sipa1l1 T G 12: 82,420,664 probably null Het
Snd1 T A 6: 28,626,127 Y394N probably damaging Het
Spaca4 A T 7: 45,725,407 V57E probably damaging Het
Spata31d1b A G 13: 59,715,464 Y142C probably benign Het
Sptbn2 A G 19: 4,745,118 K1535E probably benign Het
Srcin1 A G 11: 97,534,609 S541P probably damaging Het
Tc2n A T 12: 101,665,675 F308I probably damaging Het
Tdrd5 T C 1: 156,262,905 D857G probably benign Het
Timm22 A G 11: 76,407,308 D35G probably benign Het
Tram1l1 C A 3: 124,321,240 H16Q probably benign Het
Uggt1 T C 1: 36,151,733 Y1382C probably damaging Het
Usp32 G T 11: 84,988,553 D1443E possibly damaging Het
Uty A T Y: 1,131,072 C1046S possibly damaging Het
Wdr31 T A 4: 62,457,531 Q230L probably damaging Het
Wnt8b C A 19: 44,511,562 T196K possibly damaging Het
Xpo4 A T 14: 57,597,979 H628Q probably benign Het
Zfp780b C T 7: 27,963,957 S391N probably benign Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
Beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
Paradox UTSW 17 27098171 missense probably damaging 1.00
Pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7349:Itpr3 UTSW 17 27107812 splice site probably null
R7493:Itpr3 UTSW 17 27094800 missense probably benign 0.09
R7510:Itpr3 UTSW 17 27089039 missense probably damaging 0.97
R7565:Itpr3 UTSW 17 27110888 missense probably benign 0.01
R7616:Itpr3 UTSW 17 27088977 missense probably damaging 1.00
R7728:Itpr3 UTSW 17 27098114 missense probably damaging 1.00
R7779:Itpr3 UTSW 17 27096063 missense probably damaging 1.00
R7788:Itpr3 UTSW 17 27118597 nonsense probably null
R7871:Itpr3 UTSW 17 27117179 missense probably damaging 1.00
R7889:Itpr3 UTSW 17 27116777 missense probably damaging 1.00
R8065:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8067:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R8230:Itpr3 UTSW 17 27107737 critical splice donor site probably null
R8263:Itpr3 UTSW 17 27115913 nonsense probably null
R8269:Itpr3 UTSW 17 27093284 missense possibly damaging 0.60
R8271:Itpr3 UTSW 17 27087648 missense probably damaging 1.00
R8316:Itpr3 UTSW 17 27106225 missense possibly damaging 0.50
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z1177:Itpr3 UTSW 17 27114929 missense probably damaging 1.00
Z1177:Itpr3 UTSW 17 27119987 missense probably damaging 1.00
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAAGCCAGTTCAGATTTTCCC -3'
(R):5'- TCAAACGCTTGATCGGGTG -3'

Sequencing Primer
(F):5'- AGTTCAGATTTTCCCATGTTACG -3'
(R):5'- CTAGGGAGCTGCACTGGGTAG -3'
Posted On2019-10-07