Mutagenetix > Incidental Mutations

Incidental Mutation 'R7470:Slc26a9'

579080

Institutional Source

Beutler Lab

Gene Symbol

Slc26a9

Ensembl Gene

ENSMUSG00000042268

Gene Name

solute carrier family 26, member 9

Synonyms

anion transporter/exchanger-9, E030002L01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.859) question?

Stock #

R7470 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

131744022-131771504 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 131764043 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 675 (V675L)

Ref Sequence

ENSEMBL: ENSMUSP00000036916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000186122]

Predicted Effect

probably benign
Transcript: ENSMUST00000049027
AA Change: V675L

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: V675L

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	71	469	7.4e-99	PFAM
transmembrane domain	473	495	N/A	INTRINSIC
Pfam:STAS	520	733	2.8e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000186122

SMART Domains

Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	150	428	9.6e-58	PFAM
low complexity region	453	462	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,991,338	V238E	possibly damaging	Het
Actn3	G	A	19: 4,867,814	S375L	possibly damaging	Het
Adgrg6	T	C	10: 14,444,066	T476A	probably benign	Het
Afm	T	A	5: 90,531,627	S327T	probably damaging	Het
Apol7e	T	A	15: 77,717,943	M247K	probably benign	Het
Aqp12	T	A	1: 93,008,663	L237Q	probably damaging	Het
Arhgef12	A	T	9: 43,040,552	S63T	probably damaging	Het
Axdnd1	T	A	1: 156,376,516	E393V		Het
Cacna1g	T	A	11: 94,461,939	D365V	possibly damaging	Het
Ccdc3	T	A	2: 5,138,304	V124E	possibly damaging	Het
Ccr7	C	T	11: 99,145,557	V180M	possibly damaging	Het
Cd47	T	A	16: 49,884,222	I119K		Het
Cenpe	A	T	3: 135,242,155	L1158F	probably damaging	Het
Cfi	A	G	3: 129,855,087	R207G	probably benign	Het
Cyp2j6	T	C	4: 96,535,471	Y220C	probably benign	Het
Ddhd2	A	G	8: 25,735,060	F577L	probably benign	Het
Dhx40	T	C	11: 86,776,702	E537G	probably damaging	Het
Disp3	A	T	4: 148,261,070	C438S	possibly damaging	Het
Dock3	A	G	9: 107,005,445	S380P	probably damaging	Het
Ehmt2	A	G	17: 34,899,396	E106G	possibly damaging	Het
Fmnl2	A	T	2: 53,042,365	I119F	probably damaging	Het
Gm11554	A	C	11: 99,804,364	S8A	unknown	Het
Gm9268	T	A	7: 43,047,886	M789K	probably damaging	Het
Grm7	A	G	6: 111,501,515	I54V		Het
Hbs1l	T	C	10: 21,358,784	F579L	possibly damaging	Het
Hgf	C	A	5: 16,618,856	Q684K	probably benign	Het
Igsf3	T	C	3: 101,451,075	Y741H	possibly damaging	Het
Il17rb	C	A	14: 29,998,033	G304W	probably damaging	Het
Ino80c	C	T	18: 24,108,838	W163*	probably null	Het
Kcnt1	A	C	2: 25,909,833	D997A	probably damaging	Het
Klf7	C	T	1: 64,042,313		probably null	Het
Lingo1	T	C	9: 56,620,624	Y233C	probably damaging	Het
Lmo7	C	A	14: 101,900,604	T914K	possibly damaging	Het
Mark1	G	T	1: 184,928,044	Y138*	probably null	Het
Mcm3ap	C	A	10: 76,508,397	T1791K	probably damaging	Het
Mcts2	T	C	2: 152,687,662	I131T	probably benign	Het
Mipep	A	G	14: 60,802,895	D288G	probably benign	Het
Ms4a8a	T	A	19: 11,076,350	N131Y	possibly damaging	Het
Nalcn	T	C	14: 123,572,044	E232G	probably benign	Het
Nat10	C	T	2: 103,734,881	A452T	probably benign	Het
Nfatc2	G	A	2: 168,523,307	Q596*	probably null	Het
Nudt13	G	T	14: 20,309,723	G173W	probably damaging	Het
Olfr1	T	A	11: 73,395,888	I45F	probably damaging	Het
Olfr1157	A	T	2: 87,962,449	C148S	possibly damaging	Het
Olfr148	C	A	9: 39,613,702	T45K	probably benign	Het
Olfr878	T	A	9: 37,919,296	I213N	probably damaging	Het
Otud4	T	C	8: 79,673,360	V901A	probably benign	Het
Pah	G	A	10: 87,563,424	R155Q	probably damaging	Het
Pkd1l3	A	G	8: 109,638,376	H1130R	probably benign	Het
Pnliprp1	A	G	19: 58,732,025	N111S	possibly damaging	Het
Ppp1r21	T	C	17: 88,562,221	Y401H	probably damaging	Het
Prr14	A	G	7: 127,475,825	K466R	probably null	Het
Ralgapa2	A	G	2: 146,424,667	L663P	probably damaging	Het
Reg3d	A	T	6: 78,376,088	C171S	possibly damaging	Het
Reln	G	T	5: 21,942,741	L2404I	probably damaging	Het
Rnasel	A	C	1: 153,754,031	I98L	probably benign	Het
Rnf216	T	C	5: 142,992,725	D886G	possibly damaging	Het
Rp1l1	A	G	14: 64,028,566	R534G	probably benign	Het
Selenon	A	C	4: 134,539,750	S514A	probably benign	Het
Sema3d	T	A	5: 12,508,185	I228N	probably damaging	Het
Serpinb9g	T	A	13: 33,486,634	I35N	probably damaging	Het
Siglec1	A	C	2: 131,075,824	H1044Q	probably benign	Het
Skint5	T	A	4: 113,756,931	I693F	unknown	Het
Skint5	G	T	4: 113,885,803	L370M	unknown	Het
Slc12a1	G	A	2: 125,217,895	W905*	probably null	Het
Slc5a7	A	T	17: 54,276,962	Y433*	probably null	Het
Slc7a4	A	G	16: 17,575,113	I274T	probably benign	Het
Slmap	A	G	14: 26,427,420	V612A	probably benign	Het
Spen	T	C	4: 141,479,294	D674G	unknown	Het
Ssh1	T	C	5: 113,942,427	T981A	possibly damaging	Het
Sycp2l	T	C	13: 41,163,104	S180P	probably benign	Het
Tdrd7	C	A	4: 45,990,144	S181R	probably benign	Het
Thada	T	C	17: 84,226,041	N1661D	probably benign	Het
Tsga13	C	A	6: 30,900,046	D179Y	possibly damaging	Het
Ttf2	T	G	3: 100,963,162	Q198H	possibly damaging	Het
Ugt2b37	T	G	5: 87,254,112	Y220S	probably benign	Het
Unc79	C	T	12: 103,094,976	T1145I	probably damaging	Het
Unc80	T	A	1: 66,622,462	M1682K	probably benign	Het
Vcp	A	G	4: 42,982,891	S652P	probably damaging	Het
Wrnip1	T	A	13: 32,816,327	L439*	probably null	Het
Zfhx2	A	G	14: 55,066,750	I1259T	possibly damaging	Het
Zfp369	A	T	13: 65,292,146	T215S	probably benign	Het
Zfp64	A	T	2: 168,925,811	V627E	probably damaging	Het
Zfp873	T	C	10: 82,059,939	I168T	probably benign	Het

Other mutations in Slc26a9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Slc26a9	APN	1	131757528	missense	probably damaging	0.97
IGL01131:Slc26a9	APN	1	131755542	splice site	probably null
IGL01544:Slc26a9	APN	1	131759495	critical splice donor site	probably null
IGL01845:Slc26a9	APN	1	131757518	missense	probably damaging	0.99
IGL02125:Slc26a9	APN	1	131759437	missense	probably damaging	1.00
IGL02151:Slc26a9	APN	1	131764043	missense	probably damaging	1.00
IGL02267:Slc26a9	APN	1	131752845	missense	probably damaging	1.00
IGL02469:Slc26a9	APN	1	131762936	missense	probably damaging	0.96
IGL03137:Slc26a9	APN	1	131763877	missense	probably benign	0.01
IGL03324:Slc26a9	APN	1	131764010	missense	probably damaging	1.00
R0588:Slc26a9	UTSW	1	131754011	splice site	probably benign
R0611:Slc26a9	UTSW	1	131762761	missense	probably damaging	1.00
R0639:Slc26a9	UTSW	1	131763804	missense	probably damaging	0.97
R0654:Slc26a9	UTSW	1	131765030	missense	probably benign	0.00
R0926:Slc26a9	UTSW	1	131753216	missense	probably benign	0.40
R1109:Slc26a9	UTSW	1	131758798	missense	probably benign	0.05
R1521:Slc26a9	UTSW	1	131750677	missense	probably damaging	1.00
R1728:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1728:Slc26a9	UTSW	1	131766012	missense	probably benign
R1729:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1729:Slc26a9	UTSW	1	131766012	missense	probably benign
R1730:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1739:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1762:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1762:Slc26a9	UTSW	1	131766012	missense	probably benign
R1783:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1783:Slc26a9	UTSW	1	131766012	missense	probably benign
R1784:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1784:Slc26a9	UTSW	1	131766012	missense	probably benign
R1785:Slc26a9	UTSW	1	131763870	missense	probably benign	0.05
R1785:Slc26a9	UTSW	1	131766012	missense	probably benign
R1992:Slc26a9	UTSW	1	131762794	missense	probably damaging	1.00
R2198:Slc26a9	UTSW	1	131763263	splice site	probably benign
R3008:Slc26a9	UTSW	1	131765914	missense	probably damaging	1.00
R3409:Slc26a9	UTSW	1	131763944	missense	probably benign
R3879:Slc26a9	UTSW	1	131769231	missense	probably benign	0.39
R4064:Slc26a9	UTSW	1	131763187	missense	probably benign	0.01
R4088:Slc26a9	UTSW	1	131767849	missense	possibly damaging	0.49
R4657:Slc26a9	UTSW	1	131753138	missense	probably damaging	1.00
R5005:Slc26a9	UTSW	1	131765887	missense	probably damaging	0.99
R6255:Slc26a9	UTSW	1	131763909	missense	probably benign	0.00
R6418:Slc26a9	UTSW	1	131758490	missense	probably benign	0.06
R6442:Slc26a9	UTSW	1	131758817	missense	possibly damaging	0.58
R6674:Slc26a9	UTSW	1	131765018	missense	probably benign	0.01
R6719:Slc26a9	UTSW	1	131761785	missense	probably benign	0.13
R7202:Slc26a9	UTSW	1	131762788	missense	possibly damaging	0.77
R7214:Slc26a9	UTSW	1	131759473	missense	probably damaging	0.99
R7238:Slc26a9	UTSW	1	131758818	nonsense	probably null
R7389:Slc26a9	UTSW	1	131769248	makesense	probably null
R7439:Slc26a9	UTSW	1	131762818	missense	probably damaging	1.00
R7441:Slc26a9	UTSW	1	131762818	missense	probably damaging	1.00
R7515:Slc26a9	UTSW	1	131753973	missense	probably damaging	0.99
R7652:Slc26a9	UTSW	1	131763896	missense	probably benign	0.06
R7655:Slc26a9	UTSW	1	131763244	missense	possibly damaging	0.88
R7656:Slc26a9	UTSW	1	131763244	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AAAGTGCTCCCTCTACTGACC -3'
(R):5'- GTCCTCAACTTGCACTGAAGAG -3'

Sequencing Primer
(F):5'- AACCAAGCTCCTGCGGC -3'
(R):5'- GTGTGTCCACTCTGTTTGCATTG -3'

Posted On

2019-10-07