Incidental Mutation 'R7470:Rnasel'
ID579081
Institutional Source Beutler Lab
Gene Symbol Rnasel
Ensembl Gene ENSMUSG00000066800
Gene Nameribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms2-5A-dependent RNAase, E230029I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7470 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location153749426-153764221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 153754031 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 98 (I98L)
Ref Sequence ENSEMBL: ENSMUSP00000138247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086209] [ENSMUST00000182538] [ENSMUST00000182722] [ENSMUST00000183241]
Predicted Effect probably benign
Transcript: ENSMUST00000086209
AA Change: I98L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000083385
Gene: ENSMUSG00000066800
AA Change: I98L

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase 365 521 4.9e-19 PFAM
Pfam:Pkinase_Tyr 365 523 6.1e-14 PFAM
Pfam:Kdo 451 546 8e-8 PFAM
PUG 656 707 2.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182538
SMART Domains Protein: ENSMUSP00000138734
Gene: ENSMUSG00000066800

DomainStartEndE-ValueType
PUG 148 199 2.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182722
AA Change: I98L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138247
Gene: ENSMUSG00000066800
AA Change: I98L

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.4e-13 PFAM
Pfam:Pkinase 365 520 2.1e-18 PFAM
Pfam:Kdo 452 546 9.3e-7 PFAM
Pfam:Ribonuc_2-5A 589 651 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183241
AA Change: I98L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138752
Gene: ENSMUSG00000066800
AA Change: I98L

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.6e-13 PFAM
Pfam:Pkinase 365 517 2.4e-18 PFAM
Pfam:Kdo 452 546 9.7e-7 PFAM
Pfam:Ribonuc_2-5A 589 674 1.7e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an enlarged spleen and increased succeptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,991,338 V238E possibly damaging Het
Actn3 G A 19: 4,867,814 S375L possibly damaging Het
Adgrg6 T C 10: 14,444,066 T476A probably benign Het
Afm T A 5: 90,531,627 S327T probably damaging Het
Apol7e T A 15: 77,717,943 M247K probably benign Het
Aqp12 T A 1: 93,008,663 L237Q probably damaging Het
Arhgef12 A T 9: 43,040,552 S63T probably damaging Het
Axdnd1 T A 1: 156,376,516 E393V Het
Cacna1g T A 11: 94,461,939 D365V possibly damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Ccr7 C T 11: 99,145,557 V180M possibly damaging Het
Cd47 T A 16: 49,884,222 I119K Het
Cenpe A T 3: 135,242,155 L1158F probably damaging Het
Cfi A G 3: 129,855,087 R207G probably benign Het
Cyp2j6 T C 4: 96,535,471 Y220C probably benign Het
Ddhd2 A G 8: 25,735,060 F577L probably benign Het
Dhx40 T C 11: 86,776,702 E537G probably damaging Het
Disp3 A T 4: 148,261,070 C438S possibly damaging Het
Dock3 A G 9: 107,005,445 S380P probably damaging Het
Ehmt2 A G 17: 34,899,396 E106G possibly damaging Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Gm11554 A C 11: 99,804,364 S8A unknown Het
Gm9268 T A 7: 43,047,886 M789K probably damaging Het
Grm7 A G 6: 111,501,515 I54V Het
Hbs1l T C 10: 21,358,784 F579L possibly damaging Het
Hgf C A 5: 16,618,856 Q684K probably benign Het
Igsf3 T C 3: 101,451,075 Y741H possibly damaging Het
Il17rb C A 14: 29,998,033 G304W probably damaging Het
Ino80c C T 18: 24,108,838 W163* probably null Het
Kcnt1 A C 2: 25,909,833 D997A probably damaging Het
Klf7 C T 1: 64,042,313 probably null Het
Lingo1 T C 9: 56,620,624 Y233C probably damaging Het
Lmo7 C A 14: 101,900,604 T914K possibly damaging Het
Mark1 G T 1: 184,928,044 Y138* probably null Het
Mcm3ap C A 10: 76,508,397 T1791K probably damaging Het
Mcts2 T C 2: 152,687,662 I131T probably benign Het
Mipep A G 14: 60,802,895 D288G probably benign Het
Ms4a8a T A 19: 11,076,350 N131Y possibly damaging Het
Nalcn T C 14: 123,572,044 E232G probably benign Het
Nat10 C T 2: 103,734,881 A452T probably benign Het
Nfatc2 G A 2: 168,523,307 Q596* probably null Het
Nudt13 G T 14: 20,309,723 G173W probably damaging Het
Olfr1 T A 11: 73,395,888 I45F probably damaging Het
Olfr1157 A T 2: 87,962,449 C148S possibly damaging Het
Olfr148 C A 9: 39,613,702 T45K probably benign Het
Olfr878 T A 9: 37,919,296 I213N probably damaging Het
Otud4 T C 8: 79,673,360 V901A probably benign Het
Pah G A 10: 87,563,424 R155Q probably damaging Het
Pkd1l3 A G 8: 109,638,376 H1130R probably benign Het
Pnliprp1 A G 19: 58,732,025 N111S possibly damaging Het
Ppp1r21 T C 17: 88,562,221 Y401H probably damaging Het
Prr14 A G 7: 127,475,825 K466R probably null Het
Ralgapa2 A G 2: 146,424,667 L663P probably damaging Het
Reg3d A T 6: 78,376,088 C171S possibly damaging Het
Reln G T 5: 21,942,741 L2404I probably damaging Het
Rnf216 T C 5: 142,992,725 D886G possibly damaging Het
Rp1l1 A G 14: 64,028,566 R534G probably benign Het
Selenon A C 4: 134,539,750 S514A probably benign Het
Sema3d T A 5: 12,508,185 I228N probably damaging Het
Serpinb9g T A 13: 33,486,634 I35N probably damaging Het
Siglec1 A C 2: 131,075,824 H1044Q probably benign Het
Skint5 T A 4: 113,756,931 I693F unknown Het
Skint5 G T 4: 113,885,803 L370M unknown Het
Slc12a1 G A 2: 125,217,895 W905* probably null Het
Slc26a9 G C 1: 131,764,043 V675L probably benign Het
Slc5a7 A T 17: 54,276,962 Y433* probably null Het
Slc7a4 A G 16: 17,575,113 I274T probably benign Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Spen T C 4: 141,479,294 D674G unknown Het
Ssh1 T C 5: 113,942,427 T981A possibly damaging Het
Sycp2l T C 13: 41,163,104 S180P probably benign Het
Tdrd7 C A 4: 45,990,144 S181R probably benign Het
Thada T C 17: 84,226,041 N1661D probably benign Het
Tsga13 C A 6: 30,900,046 D179Y possibly damaging Het
Ttf2 T G 3: 100,963,162 Q198H possibly damaging Het
Ugt2b37 T G 5: 87,254,112 Y220S probably benign Het
Unc79 C T 12: 103,094,976 T1145I probably damaging Het
Unc80 T A 1: 66,622,462 M1682K probably benign Het
Vcp A G 4: 42,982,891 S652P probably damaging Het
Wrnip1 T A 13: 32,816,327 L439* probably null Het
Zfhx2 A G 14: 55,066,750 I1259T possibly damaging Het
Zfp369 A T 13: 65,292,146 T215S probably benign Het
Zfp64 A T 2: 168,925,811 V627E probably damaging Het
Zfp873 T C 10: 82,059,939 I168T probably benign Het
Other mutations in Rnasel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Rnasel APN 1 153758384 missense probably benign 0.04
IGL02662:Rnasel APN 1 153754111 missense probably damaging 1.00
IGL03215:Rnasel APN 1 153758555 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0028:Rnasel UTSW 1 153754719 missense probably benign 0.04
R0116:Rnasel UTSW 1 153754512 missense probably damaging 1.00
R0981:Rnasel UTSW 1 153759599 missense probably benign 0.03
R1523:Rnasel UTSW 1 153756013 missense probably damaging 0.98
R1538:Rnasel UTSW 1 153760794 missense possibly damaging 0.62
R1646:Rnasel UTSW 1 153755054 missense probably damaging 1.00
R1793:Rnasel UTSW 1 153754423 missense probably damaging 0.98
R1843:Rnasel UTSW 1 153754674 missense possibly damaging 0.94
R2158:Rnasel UTSW 1 153754901 missense probably damaging 1.00
R2434:Rnasel UTSW 1 153754650 missense probably damaging 1.00
R2895:Rnasel UTSW 1 153760776 missense probably damaging 1.00
R4107:Rnasel UTSW 1 153754796 missense probably benign 0.00
R5013:Rnasel UTSW 1 153753931 missense probably damaging 0.99
R5015:Rnasel UTSW 1 153754097 nonsense probably null
R5540:Rnasel UTSW 1 153755144 nonsense probably null
R5688:Rnasel UTSW 1 153753706 start gained probably benign
R5955:Rnasel UTSW 1 153754400 missense probably benign 0.05
R6131:Rnasel UTSW 1 153754460 missense probably damaging 1.00
R6164:Rnasel UTSW 1 153754392 missense probably benign 0.32
R6395:Rnasel UTSW 1 153762121 missense probably damaging 0.99
R6483:Rnasel UTSW 1 153754686 missense probably benign 0.10
R7538:Rnasel UTSW 1 153754560 missense probably benign 0.03
R8310:Rnasel UTSW 1 153754988 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGGACCGTTGTCGAAGATGATTC -3'
(R):5'- GCAAATTCACATTGGCTCCC -3'

Sequencing Primer
(F):5'- TCGTTGATCAAAGCTGTTCAGAAGG -3'
(R):5'- CACACTCATTGACGTCTG -3'
Posted On2019-10-07