Mutagenetix > Incidental Mutations

Incidental Mutation 'R7470:Rnf216'

579113

Institutional Source

Beutler Lab

Gene Symbol

Rnf216

Ensembl Gene

ENSMUSG00000045078

Gene Name

ring finger protein 216

Synonyms

2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7470 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

142990893-143112994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142992725 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 886 (D886G)

Ref Sequence

ENSEMBL: ENSMUSP00000143705 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053498
AA Change: D829G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: D829G

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197296

Predicted Effect

probably benign
Transcript: ENSMUST00000200430

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200607
AA Change: D886G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: D886G

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,991,338	V238E	possibly damaging	Het
Actn3	G	A	19: 4,867,814	S375L	possibly damaging	Het
Adgrg6	T	C	10: 14,444,066	T476A	probably benign	Het
Afm	T	A	5: 90,531,627	S327T	probably damaging	Het
Apol7e	T	A	15: 77,717,943	M247K	probably benign	Het
Aqp12	T	A	1: 93,008,663	L237Q	probably damaging	Het
Arhgef12	A	T	9: 43,040,552	S63T	probably damaging	Het
Axdnd1	T	A	1: 156,376,516	E393V		Het
Cacna1g	T	A	11: 94,461,939	D365V	possibly damaging	Het
Ccdc3	T	A	2: 5,138,304	V124E	possibly damaging	Het
Ccr7	C	T	11: 99,145,557	V180M	possibly damaging	Het
Cd47	T	A	16: 49,884,222	I119K		Het
Cenpe	A	T	3: 135,242,155	L1158F	probably damaging	Het
Cfi	A	G	3: 129,855,087	R207G	probably benign	Het
Cyp2j6	T	C	4: 96,535,471	Y220C	probably benign	Het
Ddhd2	A	G	8: 25,735,060	F577L	probably benign	Het
Dhx40	T	C	11: 86,776,702	E537G	probably damaging	Het
Disp3	A	T	4: 148,261,070	C438S	possibly damaging	Het
Dock3	A	G	9: 107,005,445	S380P	probably damaging	Het
Ehmt2	A	G	17: 34,899,396	E106G	possibly damaging	Het
Fmnl2	A	T	2: 53,042,365	I119F	probably damaging	Het
Gm11554	A	C	11: 99,804,364	S8A	unknown	Het
Gm9268	T	A	7: 43,047,886	M789K	probably damaging	Het
Grm7	A	G	6: 111,501,515	I54V		Het
Hbs1l	T	C	10: 21,358,784	F579L	possibly damaging	Het
Hgf	C	A	5: 16,618,856	Q684K	probably benign	Het
Igsf3	T	C	3: 101,451,075	Y741H	possibly damaging	Het
Il17rb	C	A	14: 29,998,033	G304W	probably damaging	Het
Ino80c	C	T	18: 24,108,838	W163*	probably null	Het
Kcnt1	A	C	2: 25,909,833	D997A	probably damaging	Het
Klf7	C	T	1: 64,042,313		probably null	Het
Lingo1	T	C	9: 56,620,624	Y233C	probably damaging	Het
Lmo7	C	A	14: 101,900,604	T914K	possibly damaging	Het
Mark1	G	T	1: 184,928,044	Y138*	probably null	Het
Mcm3ap	C	A	10: 76,508,397	T1791K	probably damaging	Het
Mcts2	T	C	2: 152,687,662	I131T	probably benign	Het
Mipep	A	G	14: 60,802,895	D288G	probably benign	Het
Ms4a8a	T	A	19: 11,076,350	N131Y	possibly damaging	Het
Nalcn	T	C	14: 123,572,044	E232G	probably benign	Het
Nat10	C	T	2: 103,734,881	A452T	probably benign	Het
Nfatc2	G	A	2: 168,523,307	Q596*	probably null	Het
Nudt13	G	T	14: 20,309,723	G173W	probably damaging	Het
Olfr1	T	A	11: 73,395,888	I45F	probably damaging	Het
Olfr1157	A	T	2: 87,962,449	C148S	possibly damaging	Het
Olfr148	C	A	9: 39,613,702	T45K	probably benign	Het
Olfr878	T	A	9: 37,919,296	I213N	probably damaging	Het
Otud4	T	C	8: 79,673,360	V901A	probably benign	Het
Pah	G	A	10: 87,563,424	R155Q	probably damaging	Het
Pkd1l3	A	G	8: 109,638,376	H1130R	probably benign	Het
Pnliprp1	A	G	19: 58,732,025	N111S	possibly damaging	Het
Ppp1r21	T	C	17: 88,562,221	Y401H	probably damaging	Het
Prr14	A	G	7: 127,475,825	K466R	probably null	Het
Ralgapa2	A	G	2: 146,424,667	L663P	probably damaging	Het
Reg3d	A	T	6: 78,376,088	C171S	possibly damaging	Het
Reln	G	T	5: 21,942,741	L2404I	probably damaging	Het
Rnasel	A	C	1: 153,754,031	I98L	probably benign	Het
Rp1l1	A	G	14: 64,028,566	R534G	probably benign	Het
Selenon	A	C	4: 134,539,750	S514A	probably benign	Het
Sema3d	T	A	5: 12,508,185	I228N	probably damaging	Het
Serpinb9g	T	A	13: 33,486,634	I35N	probably damaging	Het
Siglec1	A	C	2: 131,075,824	H1044Q	probably benign	Het
Skint5	T	A	4: 113,756,931	I693F	unknown	Het
Skint5	G	T	4: 113,885,803	L370M	unknown	Het
Slc12a1	G	A	2: 125,217,895	W905*	probably null	Het
Slc26a9	G	C	1: 131,764,043	V675L	probably benign	Het
Slc5a7	A	T	17: 54,276,962	Y433*	probably null	Het
Slc7a4	A	G	16: 17,575,113	I274T	probably benign	Het
Slmap	A	G	14: 26,427,420	V612A	probably benign	Het
Spen	T	C	4: 141,479,294	D674G	unknown	Het
Ssh1	T	C	5: 113,942,427	T981A	possibly damaging	Het
Sycp2l	T	C	13: 41,163,104	S180P	probably benign	Het
Tdrd7	C	A	4: 45,990,144	S181R	probably benign	Het
Thada	T	C	17: 84,226,041	N1661D	probably benign	Het
Tsga13	C	A	6: 30,900,046	D179Y	possibly damaging	Het
Ttf2	T	G	3: 100,963,162	Q198H	possibly damaging	Het
Ugt2b37	T	G	5: 87,254,112	Y220S	probably benign	Het
Unc79	C	T	12: 103,094,976	T1145I	probably damaging	Het
Unc80	T	A	1: 66,622,462	M1682K	probably benign	Het
Vcp	A	G	4: 42,982,891	S652P	probably damaging	Het
Wrnip1	T	A	13: 32,816,327	L439*	probably null	Het
Zfhx2	A	G	14: 55,066,750	I1259T	possibly damaging	Het
Zfp369	A	T	13: 65,292,146	T215S	probably benign	Het
Zfp64	A	T	2: 168,925,811	V627E	probably damaging	Het
Zfp873	T	C	10: 82,059,939	I168T	probably benign	Het

Other mutations in Rnf216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Rnf216	APN	5	143068910	missense	possibly damaging	0.67
IGL02502:Rnf216	APN	5	143068867	missense	probably damaging	1.00
IGL02536:Rnf216	APN	5	143080240	missense	probably benign	0.04
IGL03196:Rnf216	APN	5	143081011	missense	probably damaging	1.00
PIT4445001:Rnf216	UTSW	5	143086003	missense	probably damaging	1.00
R0270:Rnf216	UTSW	5	143080241	missense	possibly damaging	0.63
R0422:Rnf216	UTSW	5	143015654	nonsense	probably null
R0422:Rnf216	UTSW	5	143090370	missense	probably benign	0.15
R0782:Rnf216	UTSW	5	143068892	missense	possibly damaging	0.64
R1109:Rnf216	UTSW	5	143068369	missense	probably damaging	1.00
R1917:Rnf216	UTSW	5	142992806	missense	probably benign	0.03
R2233:Rnf216	UTSW	5	143090926	missense	probably benign
R2234:Rnf216	UTSW	5	143090926	missense	probably benign
R2235:Rnf216	UTSW	5	143090926	missense	probably benign
R2340:Rnf216	UTSW	5	143080334	missense	probably damaging	0.99
R3015:Rnf216	UTSW	5	143075725	critical splice donor site	probably null
R3726:Rnf216	UTSW	5	143027946	missense	probably damaging	0.96
R4231:Rnf216	UTSW	5	143093090	missense	probably damaging	1.00
R4885:Rnf216	UTSW	5	143090580	nonsense	probably null
R4942:Rnf216	UTSW	5	143093059	missense	probably damaging	1.00
R4973:Rnf216	UTSW	5	143090316	missense	probably benign
R5291:Rnf216	UTSW	5	143090212	missense	probably benign
R5307:Rnf216	UTSW	5	143093002	missense	probably damaging	1.00
R5328:Rnf216	UTSW	5	143092999	missense	possibly damaging	0.84
R5416:Rnf216	UTSW	5	143015771	nonsense	probably null
R5888:Rnf216	UTSW	5	143068314	splice site	probably null
R6048:Rnf216	UTSW	5	143068904	missense	probably damaging	1.00
R6451:Rnf216	UTSW	5	142992834	missense	possibly damaging	0.80
R6595:Rnf216	UTSW	5	143090657	missense	probably benign	0.00
R7422:Rnf216	UTSW	5	143090836	missense	probably benign	0.01
R7504:Rnf216	UTSW	5	143075759	missense	probably benign	0.27
R7507:Rnf216	UTSW	5	143089802	missense	probably damaging	1.00
R7695:Rnf216	UTSW	5	143085904	missense	possibly damaging	0.80
R7757:Rnf216	UTSW	5	143080236	missense	probably damaging	1.00
R7768:Rnf216	UTSW	5	143098444	start codon destroyed	probably null	1.00
R8056:Rnf216	UTSW	5	142992861	missense	probably benign	0.02
R8081:Rnf216	UTSW	5	143027964	missense	probably damaging	0.98
Z1176:Rnf216	UTSW	5	143098443	start codon destroyed	probably null	0.99
Z1177:Rnf216	UTSW	5	142992807	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCACTTTCGAGAGGGAATGG -3'
(R):5'- ACACCTTCAAACGCATCGGG -3'

Sequencing Primer
(F):5'- GAATGGAGGCCTTCACCCCTAC -3'
(R):5'- CCAGCTGAGAAGGTGCAGC -3'

Posted On

2019-10-07