Incidental Mutation 'R7470:Tsga13'
ID579114
Institutional Source Beutler Lab
Gene Symbol Tsga13
Ensembl Gene ENSMUSG00000039032
Gene Nametestis specific gene A13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7470 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location30896981-30915573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30900046 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 179 (D179Y)
Ref Sequence ENSEMBL: ENSMUSP00000040894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048580] [ENSMUST00000048774] [ENSMUST00000166192]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048580
AA Change: D179Y

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040894
Gene: ENSMUSG00000039032
AA Change: D179Y

DomainStartEndE-ValueType
Pfam:TSGA13 3 271 9.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048774
SMART Domains Protein: ENSMUSP00000038368
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 2.6e-134 PFAM
Pfam:COP-gamma_platf 609 756 7.7e-66 PFAM
Pfam:Coatomer_g_Cpla 758 870 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166192
SMART Domains Protein: ENSMUSP00000126726
Gene: ENSMUSG00000025607

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 380 6.5e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,991,338 V238E possibly damaging Het
Actn3 G A 19: 4,867,814 S375L possibly damaging Het
Adgrg6 T C 10: 14,444,066 T476A probably benign Het
Afm T A 5: 90,531,627 S327T probably damaging Het
Apol7e T A 15: 77,717,943 M247K probably benign Het
Aqp12 T A 1: 93,008,663 L237Q probably damaging Het
Arhgef12 A T 9: 43,040,552 S63T probably damaging Het
Axdnd1 T A 1: 156,376,516 E393V Het
Cacna1g T A 11: 94,461,939 D365V possibly damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Ccr7 C T 11: 99,145,557 V180M possibly damaging Het
Cd47 T A 16: 49,884,222 I119K Het
Cenpe A T 3: 135,242,155 L1158F probably damaging Het
Cfi A G 3: 129,855,087 R207G probably benign Het
Cyp2j6 T C 4: 96,535,471 Y220C probably benign Het
Ddhd2 A G 8: 25,735,060 F577L probably benign Het
Dhx40 T C 11: 86,776,702 E537G probably damaging Het
Disp3 A T 4: 148,261,070 C438S possibly damaging Het
Dock3 A G 9: 107,005,445 S380P probably damaging Het
Ehmt2 A G 17: 34,899,396 E106G possibly damaging Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Gm11554 A C 11: 99,804,364 S8A unknown Het
Gm9268 T A 7: 43,047,886 M789K probably damaging Het
Grm7 A G 6: 111,501,515 I54V Het
Hbs1l T C 10: 21,358,784 F579L possibly damaging Het
Hgf C A 5: 16,618,856 Q684K probably benign Het
Igsf3 T C 3: 101,451,075 Y741H possibly damaging Het
Il17rb C A 14: 29,998,033 G304W probably damaging Het
Ino80c C T 18: 24,108,838 W163* probably null Het
Kcnt1 A C 2: 25,909,833 D997A probably damaging Het
Klf7 C T 1: 64,042,313 probably null Het
Lingo1 T C 9: 56,620,624 Y233C probably damaging Het
Lmo7 C A 14: 101,900,604 T914K possibly damaging Het
Mark1 G T 1: 184,928,044 Y138* probably null Het
Mcm3ap C A 10: 76,508,397 T1791K probably damaging Het
Mcts2 T C 2: 152,687,662 I131T probably benign Het
Mipep A G 14: 60,802,895 D288G probably benign Het
Ms4a8a T A 19: 11,076,350 N131Y possibly damaging Het
Nalcn T C 14: 123,572,044 E232G probably benign Het
Nat10 C T 2: 103,734,881 A452T probably benign Het
Nfatc2 G A 2: 168,523,307 Q596* probably null Het
Nudt13 G T 14: 20,309,723 G173W probably damaging Het
Olfr1 T A 11: 73,395,888 I45F probably damaging Het
Olfr1157 A T 2: 87,962,449 C148S possibly damaging Het
Olfr148 C A 9: 39,613,702 T45K probably benign Het
Olfr878 T A 9: 37,919,296 I213N probably damaging Het
Otud4 T C 8: 79,673,360 V901A probably benign Het
Pah G A 10: 87,563,424 R155Q probably damaging Het
Pkd1l3 A G 8: 109,638,376 H1130R probably benign Het
Pnliprp1 A G 19: 58,732,025 N111S possibly damaging Het
Ppp1r21 T C 17: 88,562,221 Y401H probably damaging Het
Prr14 A G 7: 127,475,825 K466R probably null Het
Ralgapa2 A G 2: 146,424,667 L663P probably damaging Het
Reg3d A T 6: 78,376,088 C171S possibly damaging Het
Reln G T 5: 21,942,741 L2404I probably damaging Het
Rnasel A C 1: 153,754,031 I98L probably benign Het
Rnf216 T C 5: 142,992,725 D886G possibly damaging Het
Rp1l1 A G 14: 64,028,566 R534G probably benign Het
Selenon A C 4: 134,539,750 S514A probably benign Het
Sema3d T A 5: 12,508,185 I228N probably damaging Het
Serpinb9g T A 13: 33,486,634 I35N probably damaging Het
Siglec1 A C 2: 131,075,824 H1044Q probably benign Het
Skint5 T A 4: 113,756,931 I693F unknown Het
Skint5 G T 4: 113,885,803 L370M unknown Het
Slc12a1 G A 2: 125,217,895 W905* probably null Het
Slc26a9 G C 1: 131,764,043 V675L probably benign Het
Slc5a7 A T 17: 54,276,962 Y433* probably null Het
Slc7a4 A G 16: 17,575,113 I274T probably benign Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Spen T C 4: 141,479,294 D674G unknown Het
Ssh1 T C 5: 113,942,427 T981A possibly damaging Het
Sycp2l T C 13: 41,163,104 S180P probably benign Het
Tdrd7 C A 4: 45,990,144 S181R probably benign Het
Thada T C 17: 84,226,041 N1661D probably benign Het
Ttf2 T G 3: 100,963,162 Q198H possibly damaging Het
Ugt2b37 T G 5: 87,254,112 Y220S probably benign Het
Unc79 C T 12: 103,094,976 T1145I probably damaging Het
Unc80 T A 1: 66,622,462 M1682K probably benign Het
Vcp A G 4: 42,982,891 S652P probably damaging Het
Wrnip1 T A 13: 32,816,327 L439* probably null Het
Zfhx2 A G 14: 55,066,750 I1259T possibly damaging Het
Zfp369 A T 13: 65,292,146 T215S probably benign Het
Zfp64 A T 2: 168,925,811 V627E probably damaging Het
Zfp873 T C 10: 82,059,939 I168T probably benign Het
Other mutations in Tsga13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Tsga13 APN 6 30913566 missense possibly damaging 0.47
IGL02487:Tsga13 APN 6 30907427 missense probably damaging 1.00
IGL02602:Tsga13 APN 6 30902277 missense possibly damaging 0.92
R3894:Tsga13 UTSW 6 30912263 missense probably benign
R4335:Tsga13 UTSW 6 30900045 missense probably damaging 0.97
R4582:Tsga13 UTSW 6 30902363 missense probably benign 0.04
R5705:Tsga13 UTSW 6 30900016 missense probably damaging 1.00
R6248:Tsga13 UTSW 6 30897204 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGGAAACCCTATACTTCTTG -3'
(R):5'- TGTTAAGCTCTCAAACCCTACC -3'

Sequencing Primer
(F):5'- GGAAACCCTATACTTCTTGAACCTTC -3'
(R):5'- GCTCTCAAACCCTACCCTCCATC -3'
Posted On2019-10-07