Incidental Mutation 'R7470:Grm7'
ID579116
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7470 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111501515 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 54 (I54V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably benign
Transcript: ENSMUST00000071076
AA Change: I902V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: I902V

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172951
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173001
Predicted Effect probably benign
Transcript: ENSMUST00000174018
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,991,338 V238E possibly damaging Het
Actn3 G A 19: 4,867,814 S375L possibly damaging Het
Adgrg6 T C 10: 14,444,066 T476A probably benign Het
Afm T A 5: 90,531,627 S327T probably damaging Het
Apol7e T A 15: 77,717,943 M247K probably benign Het
Aqp12 T A 1: 93,008,663 L237Q probably damaging Het
Arhgef12 A T 9: 43,040,552 S63T probably damaging Het
Axdnd1 T A 1: 156,376,516 E393V Het
Cacna1g T A 11: 94,461,939 D365V possibly damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Ccr7 C T 11: 99,145,557 V180M possibly damaging Het
Cd47 T A 16: 49,884,222 I119K Het
Cenpe A T 3: 135,242,155 L1158F probably damaging Het
Cfi A G 3: 129,855,087 R207G probably benign Het
Cyp2j6 T C 4: 96,535,471 Y220C probably benign Het
Ddhd2 A G 8: 25,735,060 F577L probably benign Het
Dhx40 T C 11: 86,776,702 E537G probably damaging Het
Disp3 A T 4: 148,261,070 C438S possibly damaging Het
Dock3 A G 9: 107,005,445 S380P probably damaging Het
Ehmt2 A G 17: 34,899,396 E106G possibly damaging Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Gm11554 A C 11: 99,804,364 S8A unknown Het
Gm9268 T A 7: 43,047,886 M789K probably damaging Het
Hbs1l T C 10: 21,358,784 F579L possibly damaging Het
Hgf C A 5: 16,618,856 Q684K probably benign Het
Igsf3 T C 3: 101,451,075 Y741H possibly damaging Het
Il17rb C A 14: 29,998,033 G304W probably damaging Het
Ino80c C T 18: 24,108,838 W163* probably null Het
Kcnt1 A C 2: 25,909,833 D997A probably damaging Het
Klf7 C T 1: 64,042,313 probably null Het
Lingo1 T C 9: 56,620,624 Y233C probably damaging Het
Lmo7 C A 14: 101,900,604 T914K possibly damaging Het
Mark1 G T 1: 184,928,044 Y138* probably null Het
Mcm3ap C A 10: 76,508,397 T1791K probably damaging Het
Mcts2 T C 2: 152,687,662 I131T probably benign Het
Mipep A G 14: 60,802,895 D288G probably benign Het
Ms4a8a T A 19: 11,076,350 N131Y possibly damaging Het
Nalcn T C 14: 123,572,044 E232G probably benign Het
Nat10 C T 2: 103,734,881 A452T probably benign Het
Nfatc2 G A 2: 168,523,307 Q596* probably null Het
Nudt13 G T 14: 20,309,723 G173W probably damaging Het
Olfr1 T A 11: 73,395,888 I45F probably damaging Het
Olfr1157 A T 2: 87,962,449 C148S possibly damaging Het
Olfr148 C A 9: 39,613,702 T45K probably benign Het
Olfr878 T A 9: 37,919,296 I213N probably damaging Het
Otud4 T C 8: 79,673,360 V901A probably benign Het
Pah G A 10: 87,563,424 R155Q probably damaging Het
Pkd1l3 A G 8: 109,638,376 H1130R probably benign Het
Pnliprp1 A G 19: 58,732,025 N111S possibly damaging Het
Ppp1r21 T C 17: 88,562,221 Y401H probably damaging Het
Prr14 A G 7: 127,475,825 K466R probably null Het
Ralgapa2 A G 2: 146,424,667 L663P probably damaging Het
Reg3d A T 6: 78,376,088 C171S possibly damaging Het
Reln G T 5: 21,942,741 L2404I probably damaging Het
Rnasel A C 1: 153,754,031 I98L probably benign Het
Rnf216 T C 5: 142,992,725 D886G possibly damaging Het
Rp1l1 A G 14: 64,028,566 R534G probably benign Het
Selenon A C 4: 134,539,750 S514A probably benign Het
Sema3d T A 5: 12,508,185 I228N probably damaging Het
Serpinb9g T A 13: 33,486,634 I35N probably damaging Het
Siglec1 A C 2: 131,075,824 H1044Q probably benign Het
Skint5 T A 4: 113,756,931 I693F unknown Het
Skint5 G T 4: 113,885,803 L370M unknown Het
Slc12a1 G A 2: 125,217,895 W905* probably null Het
Slc26a9 G C 1: 131,764,043 V675L probably benign Het
Slc5a7 A T 17: 54,276,962 Y433* probably null Het
Slc7a4 A G 16: 17,575,113 I274T probably benign Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Spen T C 4: 141,479,294 D674G unknown Het
Ssh1 T C 5: 113,942,427 T981A possibly damaging Het
Sycp2l T C 13: 41,163,104 S180P probably benign Het
Tdrd7 C A 4: 45,990,144 S181R probably benign Het
Thada T C 17: 84,226,041 N1661D probably benign Het
Tsga13 C A 6: 30,900,046 D179Y possibly damaging Het
Ttf2 T G 3: 100,963,162 Q198H possibly damaging Het
Ugt2b37 T G 5: 87,254,112 Y220S probably benign Het
Unc79 C T 12: 103,094,976 T1145I probably damaging Het
Unc80 T A 1: 66,622,462 M1682K probably benign Het
Vcp A G 4: 42,982,891 S652P probably damaging Het
Wrnip1 T A 13: 32,816,327 L439* probably null Het
Zfhx2 A G 14: 55,066,750 I1259T possibly damaging Het
Zfp369 A T 13: 65,292,146 T215S probably benign Het
Zfp64 A T 2: 168,925,811 V627E probably damaging Het
Zfp873 T C 10: 82,059,939 I168T probably benign Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
Appropriated UTSW 6 111495681 missense possibly damaging 0.64
Consumed UTSW 6 111358875 missense probably damaging 1.00
Devoured UTSW 6 111358824 missense probably damaging 1.00
shaky UTSW 6 111495791 nonsense probably null
PIT4651001:Grm7 UTSW 6 110646089 missense probably benign
R0539:Grm7 UTSW 6 111359094 splice site probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
R7076:Grm7 UTSW 6 111358152 missense probably benign 0.04
R7203:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111358824 missense probably damaging 1.00
R7257:Grm7 UTSW 6 110646118 missense probably damaging 1.00
R7297:Grm7 UTSW 6 110646013 missense probably benign 0.16
R7567:Grm7 UTSW 6 111358761 missense probably damaging 0.96
R7806:Grm7 UTSW 6 111246353 nonsense probably null
R8018:Grm7 UTSW 6 111207776 missense probably benign 0.01
R8076:Grm7 UTSW 6 111566039 missense probably damaging 1.00
R8409:Grm7 UTSW 6 110914336 missense probably benign 0.02
R8420:Grm7 UTSW 6 111080354 missense probably benign
R8523:Grm7 UTSW 6 111246319 missense possibly damaging 0.76
Z1176:Grm7 UTSW 6 111358149 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTCATGGCACCAGAAGTC -3'
(R):5'- CCTATTGTCATGCATGGTGTTC -3'

Sequencing Primer
(F):5'- AGTCCAATGTTCAGAGGTACCTG -3'
(R):5'- TGTCATGCATGGTGTTCAGGAAAAC -3'
Posted On2019-10-07