Mutagenetix > Incidental Mutations

Incidental Mutation 'R7470:Arhgef12'

579124

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R7470 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43040552 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 63 (S63T)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072767
AA Change: S63T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: S63T

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165665
AA Change: S63T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: S63T

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213566

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	A	T	9: 55,991,338	V238E	possibly damaging	Het
Actn3	G	A	19: 4,867,814	S375L	possibly damaging	Het
Adgrg6	T	C	10: 14,444,066	T476A	probably benign	Het
Afm	T	A	5: 90,531,627	S327T	probably damaging	Het
Apol7e	T	A	15: 77,717,943	M247K	probably benign	Het
Aqp12	T	A	1: 93,008,663	L237Q	probably damaging	Het
Axdnd1	T	A	1: 156,376,516	E393V		Het
Cacna1g	T	A	11: 94,461,939	D365V	possibly damaging	Het
Ccdc3	T	A	2: 5,138,304	V124E	possibly damaging	Het
Ccr7	C	T	11: 99,145,557	V180M	possibly damaging	Het
Cd47	T	A	16: 49,884,222	I119K		Het
Cenpe	A	T	3: 135,242,155	L1158F	probably damaging	Het
Cfi	A	G	3: 129,855,087	R207G	probably benign	Het
Cyp2j6	T	C	4: 96,535,471	Y220C	probably benign	Het
Ddhd2	A	G	8: 25,735,060	F577L	probably benign	Het
Dhx40	T	C	11: 86,776,702	E537G	probably damaging	Het
Disp3	A	T	4: 148,261,070	C438S	possibly damaging	Het
Dock3	A	G	9: 107,005,445	S380P	probably damaging	Het
Ehmt2	A	G	17: 34,899,396	E106G	possibly damaging	Het
Fmnl2	A	T	2: 53,042,365	I119F	probably damaging	Het
Gm11554	A	C	11: 99,804,364	S8A	unknown	Het
Gm9268	T	A	7: 43,047,886	M789K	probably damaging	Het
Grm7	A	G	6: 111,501,515	I54V		Het
Hbs1l	T	C	10: 21,358,784	F579L	possibly damaging	Het
Hgf	C	A	5: 16,618,856	Q684K	probably benign	Het
Igsf3	T	C	3: 101,451,075	Y741H	possibly damaging	Het
Il17rb	C	A	14: 29,998,033	G304W	probably damaging	Het
Ino80c	C	T	18: 24,108,838	W163*	probably null	Het
Kcnt1	A	C	2: 25,909,833	D997A	probably damaging	Het
Klf7	C	T	1: 64,042,313		probably null	Het
Lingo1	T	C	9: 56,620,624	Y233C	probably damaging	Het
Lmo7	C	A	14: 101,900,604	T914K	possibly damaging	Het
Mark1	G	T	1: 184,928,044	Y138*	probably null	Het
Mcm3ap	C	A	10: 76,508,397	T1791K	probably damaging	Het
Mcts2	T	C	2: 152,687,662	I131T	probably benign	Het
Mipep	A	G	14: 60,802,895	D288G	probably benign	Het
Ms4a8a	T	A	19: 11,076,350	N131Y	possibly damaging	Het
Nalcn	T	C	14: 123,572,044	E232G	probably benign	Het
Nat10	C	T	2: 103,734,881	A452T	probably benign	Het
Nfatc2	G	A	2: 168,523,307	Q596*	probably null	Het
Nudt13	G	T	14: 20,309,723	G173W	probably damaging	Het
Olfr1	T	A	11: 73,395,888	I45F	probably damaging	Het
Olfr1157	A	T	2: 87,962,449	C148S	possibly damaging	Het
Olfr148	C	A	9: 39,613,702	T45K	probably benign	Het
Olfr878	T	A	9: 37,919,296	I213N	probably damaging	Het
Otud4	T	C	8: 79,673,360	V901A	probably benign	Het
Pah	G	A	10: 87,563,424	R155Q	probably damaging	Het
Pkd1l3	A	G	8: 109,638,376	H1130R	probably benign	Het
Pnliprp1	A	G	19: 58,732,025	N111S	possibly damaging	Het
Ppp1r21	T	C	17: 88,562,221	Y401H	probably damaging	Het
Prr14	A	G	7: 127,475,825	K466R	probably null	Het
Ralgapa2	A	G	2: 146,424,667	L663P	probably damaging	Het
Reg3d	A	T	6: 78,376,088	C171S	possibly damaging	Het
Reln	G	T	5: 21,942,741	L2404I	probably damaging	Het
Rnasel	A	C	1: 153,754,031	I98L	probably benign	Het
Rnf216	T	C	5: 142,992,725	D886G	possibly damaging	Het
Rp1l1	A	G	14: 64,028,566	R534G	probably benign	Het
Selenon	A	C	4: 134,539,750	S514A	probably benign	Het
Sema3d	T	A	5: 12,508,185	I228N	probably damaging	Het
Serpinb9g	T	A	13: 33,486,634	I35N	probably damaging	Het
Siglec1	A	C	2: 131,075,824	H1044Q	probably benign	Het
Skint5	T	A	4: 113,756,931	I693F	unknown	Het
Skint5	G	T	4: 113,885,803	L370M	unknown	Het
Slc12a1	G	A	2: 125,217,895	W905*	probably null	Het
Slc26a9	G	C	1: 131,764,043	V675L	probably benign	Het
Slc5a7	A	T	17: 54,276,962	Y433*	probably null	Het
Slc7a4	A	G	16: 17,575,113	I274T	probably benign	Het
Slmap	A	G	14: 26,427,420	V612A	probably benign	Het
Spen	T	C	4: 141,479,294	D674G	unknown	Het
Ssh1	T	C	5: 113,942,427	T981A	possibly damaging	Het
Sycp2l	T	C	13: 41,163,104	S180P	probably benign	Het
Tdrd7	C	A	4: 45,990,144	S181R	probably benign	Het
Thada	T	C	17: 84,226,041	N1661D	probably benign	Het
Tsga13	C	A	6: 30,900,046	D179Y	possibly damaging	Het
Ttf2	T	G	3: 100,963,162	Q198H	possibly damaging	Het
Ugt2b37	T	G	5: 87,254,112	Y220S	probably benign	Het
Unc79	C	T	12: 103,094,976	T1145I	probably damaging	Het
Unc80	T	A	1: 66,622,462	M1682K	probably benign	Het
Vcp	A	G	4: 42,982,891	S652P	probably damaging	Het
Wrnip1	T	A	13: 32,816,327	L439*	probably null	Het
Zfhx2	A	G	14: 55,066,750	I1259T	possibly damaging	Het
Zfp369	A	T	13: 65,292,146	T215S	probably benign	Het
Zfp64	A	T	2: 168,925,811	V627E	probably damaging	Het
Zfp873	T	C	10: 82,059,939	I168T	probably benign	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43005594	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42970990	splice site	probably null
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1458:Arhgef12	UTSW	9	42988998	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43001006	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5176:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7658:Arhgef12	UTSW	9	42992536	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTAGTGCAGCCTATTCTCAGC -3'
(R):5'- TGTTGTCACCTGTGATGTTCATAC -3'

Sequencing Primer
(F):5'- GTCATCTTAAGCTTCCATATCACAG -3'
(R):5'- GATGTTCATACTTCATGTTTGCACG -3'

Posted On

2019-10-07