Incidental Mutation 'R7470:Wrnip1'
ID 579139
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene Name Werner helicase interacting protein 1
Synonyms 4833444L21Rik, WHIP
MMRRC Submission 045544-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32986021-33006592 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 33000310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 439 (L439*)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832]
AlphaFold Q91XU0
Predicted Effect probably null
Transcript: ENSMUST00000021832
AA Change: L439*
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: L439*

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,898,622 (GRCm39) V238E possibly damaging Het
Actn3 G A 19: 4,917,842 (GRCm39) S375L possibly damaging Het
Adgrg6 T C 10: 14,319,810 (GRCm39) T476A probably benign Het
Afm T A 5: 90,679,486 (GRCm39) S327T probably damaging Het
Apol7e T A 15: 77,602,143 (GRCm39) M247K probably benign Het
Aqp12 T A 1: 92,936,385 (GRCm39) L237Q probably damaging Het
Arhgef12 A T 9: 42,951,848 (GRCm39) S63T probably damaging Het
Axdnd1 T A 1: 156,204,086 (GRCm39) E393V Het
Cacna1g T A 11: 94,352,765 (GRCm39) D365V possibly damaging Het
Ccdc3 T A 2: 5,143,115 (GRCm39) V124E possibly damaging Het
Ccr7 C T 11: 99,036,383 (GRCm39) V180M possibly damaging Het
Cd47 T A 16: 49,704,585 (GRCm39) I119K Het
Cenpe A T 3: 134,947,916 (GRCm39) L1158F probably damaging Het
Cfi A G 3: 129,648,736 (GRCm39) R207G probably benign Het
Cyp2j6 T C 4: 96,423,708 (GRCm39) Y220C probably benign Het
Ddhd2 A G 8: 26,225,087 (GRCm39) F577L probably benign Het
Dhx40 T C 11: 86,667,528 (GRCm39) E537G probably damaging Het
Disp3 A T 4: 148,345,527 (GRCm39) C438S possibly damaging Het
Dock3 A G 9: 106,882,644 (GRCm39) S380P probably damaging Het
Ehmt2 A G 17: 35,118,372 (GRCm39) E106G possibly damaging Het
Fmnl2 A T 2: 52,932,377 (GRCm39) I119F probably damaging Het
Gm11554 A C 11: 99,695,190 (GRCm39) S8A unknown Het
Grm7 A G 6: 111,478,476 (GRCm39) I54V Het
Hbs1l T C 10: 21,234,683 (GRCm39) F579L possibly damaging Het
Hgf C A 5: 16,823,854 (GRCm39) Q684K probably benign Het
Igsf3 T C 3: 101,358,391 (GRCm39) Y741H possibly damaging Het
Il17rb C A 14: 29,719,990 (GRCm39) G304W probably damaging Het
Ino80c C T 18: 24,241,895 (GRCm39) W163* probably null Het
Kcnt1 A C 2: 25,799,845 (GRCm39) D997A probably damaging Het
Klf7 C T 1: 64,081,472 (GRCm39) probably null Het
Lingo1 T C 9: 56,527,908 (GRCm39) Y233C probably damaging Het
Lmo7 C A 14: 102,138,040 (GRCm39) T914K possibly damaging Het
Mark1 G T 1: 184,660,241 (GRCm39) Y138* probably null Het
Mcm3ap C A 10: 76,344,231 (GRCm39) T1791K probably damaging Het
Mcts2 T C 2: 152,529,582 (GRCm39) I131T probably benign Het
Mipep A G 14: 61,040,344 (GRCm39) D288G probably benign Het
Ms4a8a T A 19: 11,053,714 (GRCm39) N131Y possibly damaging Het
Nalcn T C 14: 123,809,456 (GRCm39) E232G probably benign Het
Nat10 C T 2: 103,565,226 (GRCm39) A452T probably benign Het
Nfatc2 G A 2: 168,365,227 (GRCm39) Q596* probably null Het
Nudt13 G T 14: 20,359,791 (GRCm39) G173W probably damaging Het
Or10n1 C A 9: 39,524,998 (GRCm39) T45K probably benign Het
Or1e16 T A 11: 73,286,714 (GRCm39) I45F probably damaging Het
Or5l14 A T 2: 87,792,793 (GRCm39) C148S possibly damaging Het
Or8b4 T A 9: 37,830,592 (GRCm39) I213N probably damaging Het
Otud4 T C 8: 80,399,989 (GRCm39) V901A probably benign Het
Pah G A 10: 87,399,286 (GRCm39) R155Q probably damaging Het
Pkd1l3 A G 8: 110,365,008 (GRCm39) H1130R probably benign Het
Pnliprp1 A G 19: 58,720,457 (GRCm39) N111S possibly damaging Het
Ppp1r21 T C 17: 88,869,649 (GRCm39) Y401H probably damaging Het
Prr14 A G 7: 127,074,997 (GRCm39) K466R probably null Het
Ralgapa2 A G 2: 146,266,587 (GRCm39) L663P probably damaging Het
Reg3d A T 6: 78,353,071 (GRCm39) C171S possibly damaging Het
Reln G T 5: 22,147,739 (GRCm39) L2404I probably damaging Het
Rnasel A C 1: 153,629,777 (GRCm39) I98L probably benign Het
Rnf216 T C 5: 142,978,480 (GRCm39) D886G possibly damaging Het
Rp1l1 A G 14: 64,266,015 (GRCm39) R534G probably benign Het
Selenon A C 4: 134,267,061 (GRCm39) S514A probably benign Het
Sema3d T A 5: 12,558,152 (GRCm39) I228N probably damaging Het
Serpinb9g T A 13: 33,670,617 (GRCm39) I35N probably damaging Het
Siglec1 A C 2: 130,917,744 (GRCm39) H1044Q probably benign Het
Skint5 T A 4: 113,614,128 (GRCm39) I693F unknown Het
Skint5 G T 4: 113,743,000 (GRCm39) L370M unknown Het
Slc12a1 G A 2: 125,059,815 (GRCm39) W905* probably null Het
Slc26a9 G C 1: 131,691,781 (GRCm39) V675L probably benign Het
Slc5a7 A T 17: 54,583,990 (GRCm39) Y433* probably null Het
Slc7a4 A G 16: 17,392,977 (GRCm39) I274T probably benign Het
Slmap A G 14: 26,148,575 (GRCm39) V612A probably benign Het
Spen T C 4: 141,206,605 (GRCm39) D674G unknown Het
Ssh1 T C 5: 114,080,488 (GRCm39) T981A possibly damaging Het
Sycp2l T C 13: 41,316,580 (GRCm39) S180P probably benign Het
Tdrd7 C A 4: 45,990,144 (GRCm39) S181R probably benign Het
Thada T C 17: 84,533,469 (GRCm39) N1661D probably benign Het
Tsga13 C A 6: 30,876,981 (GRCm39) D179Y possibly damaging Het
Ttf2 T G 3: 100,870,478 (GRCm39) Q198H possibly damaging Het
Ugt2b37 T G 5: 87,401,971 (GRCm39) Y220S probably benign Het
Unc79 C T 12: 103,061,235 (GRCm39) T1145I probably damaging Het
Unc80 T A 1: 66,661,621 (GRCm39) M1682K probably benign Het
Vcp A G 4: 42,982,891 (GRCm39) S652P probably damaging Het
Vmn2r-ps158 T A 7: 42,697,310 (GRCm39) M789K probably damaging Het
Zfhx2 A G 14: 55,304,207 (GRCm39) I1259T possibly damaging Het
Zfp369 A T 13: 65,439,960 (GRCm39) T215S probably benign Het
Zfp64 A T 2: 168,767,731 (GRCm39) V627E probably damaging Het
Zfp873 T C 10: 81,895,773 (GRCm39) I168T probably benign Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 33,000,312 (GRCm39) missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32,990,857 (GRCm39) missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 33,006,053 (GRCm39) missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 33,004,280 (GRCm39) missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32,990,847 (GRCm39) missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 33,005,889 (GRCm39) missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32,990,796 (GRCm39) missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 33,005,073 (GRCm39) missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32,989,362 (GRCm39) missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32,989,319 (GRCm39) critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 33,004,223 (GRCm39) missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32,986,410 (GRCm39) missense probably benign
R2475:Wrnip1 UTSW 13 32,990,941 (GRCm39) missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32,986,744 (GRCm39) missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32,990,866 (GRCm39) missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32,986,330 (GRCm39) missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 33,000,295 (GRCm39) missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 33,000,319 (GRCm39) missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32,990,839 (GRCm39) missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32,990,949 (GRCm39) missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32,986,739 (GRCm39) missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32,986,732 (GRCm39) missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32,986,616 (GRCm39) missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 33,000,264 (GRCm39) missense probably benign 0.33
R7468:Wrnip1 UTSW 13 33,000,360 (GRCm39) missense possibly damaging 0.80
R8049:Wrnip1 UTSW 13 33,005,960 (GRCm39) missense probably benign
R8260:Wrnip1 UTSW 13 32,989,339 (GRCm39) missense possibly damaging 0.80
R9000:Wrnip1 UTSW 13 32,986,711 (GRCm39) missense probably damaging 0.99
X0019:Wrnip1 UTSW 13 32,990,749 (GRCm39) missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32,986,707 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGACTTAGGAAACTTGGTCAG -3'
(R):5'- GAGCTGTGGGCACATTTGTC -3'

Sequencing Primer
(F):5'- AGGAAACTTGGTCAGTTCTTAGTC -3'
(R):5'- GGGCACATTTGTCCCTGCAC -3'
Posted On 2019-10-07