Incidental Mutation 'R7471:Inpp5d'
ID579167
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R7471 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87695400 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 405 (D405G)
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
Predicted Effect probably damaging
Transcript: ENSMUST00000042275
AA Change: D404G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: D404G

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072999
AA Change: D404G

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: D404G

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167032
AA Change: D142G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: D142G

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: D405G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: D405G

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169754
AA Change: D405G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: D405G

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170300
AA Change: D142G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: D142G

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T C 11: 105,973,482 V483A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Angptl2 A T 2: 33,243,739 T358S possibly damaging Het
Apoh C T 11: 108,407,305 P144S probably damaging Het
Arid1a A G 4: 133,681,044 W1666R unknown Het
Asap3 A G 4: 136,233,646 H223R possibly damaging Het
Bcl2l12 A G 7: 44,996,553 S81P possibly damaging Het
C8a A G 4: 104,817,625 S550P probably benign Het
Cacna2d1 C G 5: 15,934,975 probably benign Het
Ccdc170 A G 10: 4,520,803 T216A probably benign Het
Chd7 A T 4: 8,859,197 K2429I probably damaging Het
Chd8 T C 14: 52,204,112 N2181S probably benign Het
Clip3 T C 7: 30,301,952 V342A possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Cyp20a1 T C 1: 60,354,640 F139S probably damaging Het
Dclre1b T A 3: 103,803,114 R494W probably benign Het
Dicer1 A G 12: 104,694,710 I1695T probably damaging Het
Dnah7a A G 1: 53,419,699 L3760P probably damaging Het
Dock1 A G 7: 135,163,343 D1688G possibly damaging Het
Drosha G A 15: 12,889,656 R870Q probably damaging Het
Dsg2 G T 18: 20,580,618 M215I probably benign Het
Dst A T 1: 34,194,570 D3453V possibly damaging Het
Epha10 A T 4: 124,902,572 Y358F Het
Ermp1 A T 19: 29,612,654 M853K probably benign Het
Hace1 T G 10: 45,700,979 I823S probably benign Het
Hectd3 A T 4: 116,996,588 Y227F probably benign Het
Hells A G 19: 38,957,057 N580S probably benign Het
Igkv12-44 A G 6: 69,814,734 F82L probably damaging Het
Itsn2 G A 12: 4,708,198 R1508H probably benign Het
Lingo1 T A 9: 56,620,883 K147* probably null Het
Ltn1 T C 16: 87,397,899 S1371G probably benign Het
Mab21l1 A G 3: 55,783,886 D298G possibly damaging Het
Macf1 A T 4: 123,472,289 V2893E probably benign Het
Mapk8ip1 T C 2: 92,389,144 D114G probably benign Het
Med15 A T 16: 17,722,865 W6R probably benign Het
Mrps34 T C 17: 24,895,457 L97P probably damaging Het
Myrfl A T 10: 116,861,512 F36I possibly damaging Het
Nifk G A 1: 118,332,474 S253N probably damaging Het
Nmnat1 T A 4: 149,473,301 T95S probably damaging Het
Oasl1 T A 5: 114,935,926 I298N probably damaging Het
Odf3l1 C T 9: 56,852,499 probably null Het
Olfr570 A G 7: 102,900,553 Y62C probably benign Het
Olfr689 T G 7: 105,314,505 L167R probably damaging Het
Olfr970 A T 9: 39,820,127 M163L probably benign Het
Polr2b C T 5: 77,321,066 R230* probably null Het
Prkra T A 2: 76,647,201 E53D probably benign Het
Rasgrp4 T A 7: 29,145,980 L376Q probably damaging Het
Rwdd3 A G 3: 121,171,312 S65P probably benign Het
Satb1 G A 17: 51,783,001 P273S probably damaging Het
Scg3 T C 9: 75,682,092 E93G probably damaging Het
Sf3a1 T C 11: 4,167,724 F162S possibly damaging Het
Sorcs1 A G 19: 50,262,263 Y377H probably damaging Het
Sptbn4 G A 7: 27,409,014 A661V possibly damaging Het
Stk36 A G 1: 74,634,320 N996S unknown Het
Tbca A T 13: 94,832,415 I37F probably damaging Het
Tc2n A T 12: 101,706,457 V75E probably damaging Het
Tdrkh A T 3: 94,425,956 S243C probably damaging Het
Tjp1 T C 7: 65,314,690 D911G probably damaging Het
Tob1 T A 11: 94,213,882 D81E probably benign Het
Usp37 A T 1: 74,495,628 probably null Het
Vmn1r235 A G 17: 21,262,396 I328V probably benign Het
Vmn1r28 T A 6: 58,265,865 L231* probably null Het
Xirp1 G A 9: 120,019,110 Q236* probably null Het
Zc3h7b A G 15: 81,780,481 T514A probably damaging Het
Zfp524 A G 7: 5,018,201 I243V probably benign Het
Zfp655 T A 5: 145,244,732 Y467N possibly damaging Het
Zfp985 A T 4: 147,582,931 K85N possibly damaging Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAATGCATCTCTCCGGGTG -3'
(R):5'- TCCTCTGACAAAGGTAGAATTCTCTAG -3'

Sequencing Primer
(F):5'- ATCTCTCCGGGTGGCTGC -3'
(R):5'- TCTAGAAAAGAGGTTGTATAGATGGG -3'
Posted On2019-10-07