Incidental Mutation 'R7471:Xirp1'
ID579206
Institutional Source Beutler Lab
Gene Symbol Xirp1
Ensembl Gene ENSMUSG00000079243
Gene Namexin actin-binding repeat containing 1
SynonymsCmya1, Xin, mXin alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R7471 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120013755-120023598 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 120019110 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 236 (Q236*)
Ref Sequence ENSEMBL: ENSMUSP00000107262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111635] [ENSMUST00000177637] [ENSMUST00000213113]
Predicted Effect probably null
Transcript: ENSMUST00000111635
AA Change: Q236*
SMART Domains Protein: ENSMUSP00000107262
Gene: ENSMUSG00000079243
AA Change: Q236*

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Pfam:Xin 89 104 1.7e-9 PFAM
Pfam:Xin 151 166 2.1e-9 PFAM
Pfam:Xin 186 201 1.6e-9 PFAM
Pfam:Xin 266 279 4.8e-9 PFAM
Pfam:Xin 303 317 1.1e-10 PFAM
Pfam:Xin 341 355 5.6e-8 PFAM
Pfam:Xin 376 391 6.7e-11 PFAM
Pfam:Xin 511 526 1.5e-12 PFAM
Pfam:Xin 549 563 2.6e-11 PFAM
Pfam:Xin 593 607 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213113
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit cardiac hypertrophy and a disruption of cardiac intercalated disc structure and myofilament abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A C 19: 29,729,739 probably null Het
Acaca T A 11: 84,277,782 probably null Het
Ace T C 11: 105,973,482 V483A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Angptl2 A T 2: 33,243,739 T358S possibly damaging Het
Apoh C T 11: 108,407,305 P144S probably damaging Het
Arid1a A G 4: 133,681,044 W1666R unknown Het
Asap3 A G 4: 136,233,646 H223R possibly damaging Het
Bcl2l12 A G 7: 44,996,553 S81P possibly damaging Het
C8a A G 4: 104,817,625 S550P probably benign Het
Cacna2d1 C G 5: 15,934,975 probably benign Het
Ccdc170 A G 10: 4,520,803 T216A probably benign Het
Chd7 A T 4: 8,859,197 K2429I probably damaging Het
Chd8 T C 14: 52,204,112 N2181S probably benign Het
Clip3 T C 7: 30,301,952 V342A possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Cyp20a1 T C 1: 60,354,640 F139S probably damaging Het
Dclre1b T A 3: 103,803,114 R494W probably benign Het
Dicer1 A G 12: 104,694,710 I1695T probably damaging Het
Dnah7a A G 1: 53,419,699 L3760P probably damaging Het
Dock1 A G 7: 135,163,343 D1688G possibly damaging Het
Drosha G A 15: 12,889,656 R870Q probably damaging Het
Dsg2 G T 18: 20,580,618 M215I probably benign Het
Dst A T 1: 34,194,570 D3453V possibly damaging Het
Epha10 A T 4: 124,902,572 Y358F Het
Ermp1 A T 19: 29,612,654 M853K probably benign Het
Hace1 T G 10: 45,700,979 I823S probably benign Het
Hectd3 A T 4: 116,996,588 Y227F probably benign Het
Hells A G 19: 38,957,057 N580S probably benign Het
Igkv12-44 A G 6: 69,814,734 F82L probably damaging Het
Inpp5d A G 1: 87,695,400 D405G probably damaging Het
Itsn2 G A 12: 4,708,198 R1508H probably benign Het
Limk1 A T 5: 134,657,971 probably null Het
Lingo1 T A 9: 56,620,883 K147* probably null Het
Ltn1 T C 16: 87,397,899 S1371G probably benign Het
Mab21l1 A G 3: 55,783,886 D298G possibly damaging Het
Macf1 A T 4: 123,472,289 V2893E probably benign Het
Mapk8ip1 T C 2: 92,389,144 D114G probably benign Het
Med15 A T 16: 17,722,865 W6R probably benign Het
Mrps34 T C 17: 24,895,457 L97P probably damaging Het
Myrfl A T 10: 116,861,512 F36I possibly damaging Het
Nifk G A 1: 118,332,474 S253N probably damaging Het
Nmnat1 T A 4: 149,473,301 T95S probably damaging Het
Oasl1 T A 5: 114,935,926 I298N probably damaging Het
Odf3l1 C T 9: 56,852,499 probably null Het
Olfr570 A G 7: 102,900,553 Y62C probably benign Het
Olfr689 T G 7: 105,314,505 L167R probably damaging Het
Olfr970 A T 9: 39,820,127 M163L probably benign Het
Polr2b C T 5: 77,321,066 R230* probably null Het
Prkra T A 2: 76,647,201 E53D probably benign Het
Rasgrp4 T A 7: 29,145,980 L376Q probably damaging Het
Rwdd3 A G 3: 121,171,312 S65P probably benign Het
Satb1 G A 17: 51,783,001 P273S probably damaging Het
Scg3 T C 9: 75,682,092 E93G probably damaging Het
Sf3a1 T C 11: 4,167,724 F162S possibly damaging Het
Sorcs1 A G 19: 50,262,263 Y377H probably damaging Het
Sptbn4 G A 7: 27,409,014 A661V possibly damaging Het
Stk36 A G 1: 74,634,320 N996S unknown Het
Tbca A T 13: 94,832,415 I37F probably damaging Het
Tc2n A T 12: 101,706,457 V75E probably damaging Het
Tdrkh A T 3: 94,425,956 S243C probably damaging Het
Tjp1 T C 7: 65,314,690 D911G probably damaging Het
Tmbim6 A G 15: 99,401,443 probably benign Het
Tob1 T A 11: 94,213,882 D81E probably benign Het
Ttpal T A 2: 163,607,025 probably null Het
Usp37 A T 1: 74,495,628 probably null Het
Vmn1r235 A G 17: 21,262,396 I328V probably benign Het
Vmn1r28 T A 6: 58,265,865 L231* probably null Het
Zc3h7b A G 15: 81,780,481 T514A probably damaging Het
Zfp524 A G 7: 5,018,201 I243V probably benign Het
Zfp655 T A 5: 145,244,732 Y467N possibly damaging Het
Zfp985 A T 4: 147,582,931 K85N possibly damaging Het
Other mutations in Xirp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Xirp1 APN 9 120017919 missense probably damaging 1.00
IGL02105:Xirp1 APN 9 120016997 missense probably damaging 1.00
IGL03365:Xirp1 APN 9 120018539 missense probably damaging 0.99
busybody UTSW 9 120019753 missense possibly damaging 0.92
Buzzer UTSW 9 120018491 missense probably damaging 1.00
cornflower UTSW 9 120019815 start codon destroyed probably null 0.89
R0006:Xirp1 UTSW 9 120017454 missense probably benign 0.01
R0320:Xirp1 UTSW 9 120016467 missense probably benign 0.00
R0881:Xirp1 UTSW 9 120018417 missense possibly damaging 0.69
R1220:Xirp1 UTSW 9 120017916 missense possibly damaging 0.95
R1707:Xirp1 UTSW 9 120018775 missense possibly damaging 0.53
R1783:Xirp1 UTSW 9 120016907 missense probably benign
R1785:Xirp1 UTSW 9 120016907 missense probably benign
R1978:Xirp1 UTSW 9 120018591 missense probably benign 0.00
R1983:Xirp1 UTSW 9 120016629 nonsense probably null
R2064:Xirp1 UTSW 9 120016896 missense probably benign 0.00
R2860:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2860:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2919:Xirp1 UTSW 9 120018701 missense possibly damaging 0.81
R3013:Xirp1 UTSW 9 120019785 missense probably benign
R3704:Xirp1 UTSW 9 120016907 missense probably benign 0.04
R3898:Xirp1 UTSW 9 120019340 missense probably benign 0.00
R3981:Xirp1 UTSW 9 120017744 missense probably damaging 0.98
R4609:Xirp1 UTSW 9 120016506 missense probably benign
R4613:Xirp1 UTSW 9 120019682 missense probably damaging 1.00
R4660:Xirp1 UTSW 9 120016992 missense probably damaging 1.00
R4703:Xirp1 UTSW 9 120017027 missense probably damaging 1.00
R4825:Xirp1 UTSW 9 120017003 missense possibly damaging 0.77
R4993:Xirp1 UTSW 9 120018792 missense probably damaging 1.00
R5297:Xirp1 UTSW 9 120019602 missense probably damaging 1.00
R5939:Xirp1 UTSW 9 120018509 missense probably benign 0.01
R6091:Xirp1 UTSW 9 120017963 missense probably benign 0.01
R6290:Xirp1 UTSW 9 120018725 missense probably benign
R6376:Xirp1 UTSW 9 120018491 missense probably damaging 1.00
R6515:Xirp1 UTSW 9 120016917 missense probably benign 0.00
R6616:Xirp1 UTSW 9 120019014 missense probably damaging 0.98
R6976:Xirp1 UTSW 9 120017918 missense probably damaging 1.00
R7165:Xirp1 UTSW 9 120019047 missense probably damaging 1.00
R7744:Xirp1 UTSW 9 120016846 missense possibly damaging 0.77
R7847:Xirp1 UTSW 9 120019753 missense possibly damaging 0.92
R8010:Xirp1 UTSW 9 120017824 missense probably benign 0.00
R8371:Xirp1 UTSW 9 120019433 missense possibly damaging 0.78
V8831:Xirp1 UTSW 9 120016907 missense probably benign
X0025:Xirp1 UTSW 9 120019155 missense probably damaging 1.00
Z1088:Xirp1 UTSW 9 120016907 missense probably benign
Z1176:Xirp1 UTSW 9 120016880 missense probably damaging 0.96
Z1176:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120017154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAACGAGTTGCACTGACATCC -3'
(R):5'- TGAGACCAAGCCACTGGATG -3'

Sequencing Primer
(F):5'- TTGCACTGACATCCGGCAG -3'
(R):5'- AAGCCACTGGATGCGCTG -3'
Posted On2019-10-07