Incidental Mutation 'R7471:Sf3a1'
ID579210
Institutional Source Beutler Lab
Gene Symbol Sf3a1
Ensembl Gene ENSMUSG00000002129
Gene Namesplicing factor 3a, subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7471 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4160350-4182541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4167724 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 162 (F162S)
Ref Sequence ENSEMBL: ENSMUSP00000002198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002198]
PDB Structure
Solution structure of Ubiquitin-like domain in SF3a120 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002198
AA Change: F162S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002198
Gene: ENSMUSG00000002129
AA Change: F162S

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SWAP 50 103 4.99e-30 SMART
low complexity region 118 138 N/A INTRINSIC
SWAP 164 217 3.22e-24 SMART
Pfam:PRP21_like_P 227 469 7e-81 PFAM
low complexity region 552 560 N/A INTRINSIC
low complexity region 574 589 N/A INTRINSIC
low complexity region 624 673 N/A INTRINSIC
UBQ 713 784 6.52e-18 SMART
Meta Mutation Damage Score 0.4700 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A C 19: 29,729,739 probably null Het
Acaca T A 11: 84,277,782 probably null Het
Ace T C 11: 105,973,482 V483A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Angptl2 A T 2: 33,243,739 T358S possibly damaging Het
Apoh C T 11: 108,407,305 P144S probably damaging Het
Arid1a A G 4: 133,681,044 W1666R unknown Het
Asap3 A G 4: 136,233,646 H223R possibly damaging Het
Bcl2l12 A G 7: 44,996,553 S81P possibly damaging Het
C8a A G 4: 104,817,625 S550P probably benign Het
Cacna2d1 C G 5: 15,934,975 probably benign Het
Ccdc170 A G 10: 4,520,803 T216A probably benign Het
Chd7 A T 4: 8,859,197 K2429I probably damaging Het
Chd8 T C 14: 52,204,112 N2181S probably benign Het
Clip3 T C 7: 30,301,952 V342A possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Cyp20a1 T C 1: 60,354,640 F139S probably damaging Het
Dclre1b T A 3: 103,803,114 R494W probably benign Het
Dicer1 A G 12: 104,694,710 I1695T probably damaging Het
Dnah7a A G 1: 53,419,699 L3760P probably damaging Het
Dock1 A G 7: 135,163,343 D1688G possibly damaging Het
Drosha G A 15: 12,889,656 R870Q probably damaging Het
Dsg2 G T 18: 20,580,618 M215I probably benign Het
Dst A T 1: 34,194,570 D3453V possibly damaging Het
Epha10 A T 4: 124,902,572 Y358F Het
Ermp1 A T 19: 29,612,654 M853K probably benign Het
Hace1 T G 10: 45,700,979 I823S probably benign Het
Hectd3 A T 4: 116,996,588 Y227F probably benign Het
Hells A G 19: 38,957,057 N580S probably benign Het
Igkv12-44 A G 6: 69,814,734 F82L probably damaging Het
Inpp5d A G 1: 87,695,400 D405G probably damaging Het
Itsn2 G A 12: 4,708,198 R1508H probably benign Het
Limk1 A T 5: 134,657,971 probably null Het
Lingo1 T A 9: 56,620,883 K147* probably null Het
Ltn1 T C 16: 87,397,899 S1371G probably benign Het
Mab21l1 A G 3: 55,783,886 D298G possibly damaging Het
Macf1 A T 4: 123,472,289 V2893E probably benign Het
Mapk8ip1 T C 2: 92,389,144 D114G probably benign Het
Med15 A T 16: 17,722,865 W6R probably benign Het
Mrps34 T C 17: 24,895,457 L97P probably damaging Het
Myrfl A T 10: 116,861,512 F36I possibly damaging Het
Nifk G A 1: 118,332,474 S253N probably damaging Het
Nmnat1 T A 4: 149,473,301 T95S probably damaging Het
Oasl1 T A 5: 114,935,926 I298N probably damaging Het
Odf3l1 C T 9: 56,852,499 probably null Het
Olfr570 A G 7: 102,900,553 Y62C probably benign Het
Olfr689 T G 7: 105,314,505 L167R probably damaging Het
Olfr970 A T 9: 39,820,127 M163L probably benign Het
Polr2b C T 5: 77,321,066 R230* probably null Het
Prkra T A 2: 76,647,201 E53D probably benign Het
Rasgrp4 T A 7: 29,145,980 L376Q probably damaging Het
Rwdd3 A G 3: 121,171,312 S65P probably benign Het
Satb1 G A 17: 51,783,001 P273S probably damaging Het
Scg3 T C 9: 75,682,092 E93G probably damaging Het
Sorcs1 A G 19: 50,262,263 Y377H probably damaging Het
Sptbn4 G A 7: 27,409,014 A661V possibly damaging Het
Stk36 A G 1: 74,634,320 N996S unknown Het
Tbca A T 13: 94,832,415 I37F probably damaging Het
Tc2n A T 12: 101,706,457 V75E probably damaging Het
Tdrkh A T 3: 94,425,956 S243C probably damaging Het
Tjp1 T C 7: 65,314,690 D911G probably damaging Het
Tmbim6 A G 15: 99,401,443 probably benign Het
Tob1 T A 11: 94,213,882 D81E probably benign Het
Ttpal T A 2: 163,607,025 probably null Het
Usp37 A T 1: 74,495,628 probably null Het
Vmn1r235 A G 17: 21,262,396 I328V probably benign Het
Vmn1r28 T A 6: 58,265,865 L231* probably null Het
Xirp1 G A 9: 120,019,110 Q236* probably null Het
Zc3h7b A G 15: 81,780,481 T514A probably damaging Het
Zfp524 A G 7: 5,018,201 I243V probably benign Het
Zfp655 T A 5: 145,244,732 Y467N possibly damaging Het
Zfp985 A T 4: 147,582,931 K85N possibly damaging Het
Other mutations in Sf3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sf3a1 APN 11 4171063 missense probably damaging 1.00
IGL02883:Sf3a1 APN 11 4179192 missense probably damaging 1.00
IGL03061:Sf3a1 APN 11 4175493 missense probably damaging 1.00
R1469:Sf3a1 UTSW 11 4175380 splice site probably benign
R1561:Sf3a1 UTSW 11 4179217 missense probably benign
R1905:Sf3a1 UTSW 11 4176678 missense probably benign 0.01
R1993:Sf3a1 UTSW 11 4179177 missense possibly damaging 0.51
R2264:Sf3a1 UTSW 11 4177443 missense probably benign 0.28
R3935:Sf3a1 UTSW 11 4180024 splice site probably null
R3936:Sf3a1 UTSW 11 4180024 splice site probably null
R4065:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4067:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4245:Sf3a1 UTSW 11 4167774 missense probably damaging 1.00
R5167:Sf3a1 UTSW 11 4177456 missense possibly damaging 0.71
R5434:Sf3a1 UTSW 11 4174041 missense probably damaging 1.00
R7506:Sf3a1 UTSW 11 4177561 missense probably benign 0.02
R8039:Sf3a1 UTSW 11 4167787 missense probably damaging 1.00
R8074:Sf3a1 UTSW 11 4175435 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTGGGTGAGACACTGATAAC -3'
(R):5'- AACCCAGCACCTTGGTATACTG -3'

Sequencing Primer
(F):5'- ACCAATCTTCTAGCAAGTTCCAGTG -3'
(R):5'- GCTCCACCAGCTTTGTGAAGTAG -3'
Posted On2019-10-07