Incidental Mutation 'R7471:Tob1'
ID579211
Institutional Source Beutler Lab
Gene Symbol Tob1
Ensembl Gene ENSMUSG00000037573
Gene Nametransducer of ErbB-2.1
SynonymsTrob, Tob
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7471 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94211454-94215495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94213882 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 81 (D81E)
Ref Sequence ENSEMBL: ENSMUSP00000036039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041589]
Predicted Effect probably benign
Transcript: ENSMUST00000041589
AA Change: D81E

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036039
Gene: ENSMUSG00000037573
AA Change: D81E

DomainStartEndE-ValueType
btg1 1 106 2.41e-77 SMART
low complexity region 141 160 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
low complexity region 238 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducer of erbB-2 /B-cell translocation gene protein family. Members of this family are anti-proliferative factors that have the potential to regulate cell growth. The encoded protein may function as a tumor suppressor. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable and exhibit increased bone mass due to increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A C 19: 29,729,739 probably null Het
Acaca T A 11: 84,277,782 probably null Het
Ace T C 11: 105,973,482 V483A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Angptl2 A T 2: 33,243,739 T358S possibly damaging Het
Apoh C T 11: 108,407,305 P144S probably damaging Het
Arid1a A G 4: 133,681,044 W1666R unknown Het
Asap3 A G 4: 136,233,646 H223R possibly damaging Het
Bcl2l12 A G 7: 44,996,553 S81P possibly damaging Het
C8a A G 4: 104,817,625 S550P probably benign Het
Cacna2d1 C G 5: 15,934,975 probably benign Het
Ccdc170 A G 10: 4,520,803 T216A probably benign Het
Chd7 A T 4: 8,859,197 K2429I probably damaging Het
Chd8 T C 14: 52,204,112 N2181S probably benign Het
Clip3 T C 7: 30,301,952 V342A possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Cyp20a1 T C 1: 60,354,640 F139S probably damaging Het
Dclre1b T A 3: 103,803,114 R494W probably benign Het
Dicer1 A G 12: 104,694,710 I1695T probably damaging Het
Dnah7a A G 1: 53,419,699 L3760P probably damaging Het
Dock1 A G 7: 135,163,343 D1688G possibly damaging Het
Drosha G A 15: 12,889,656 R870Q probably damaging Het
Dsg2 G T 18: 20,580,618 M215I probably benign Het
Dst A T 1: 34,194,570 D3453V possibly damaging Het
Epha10 A T 4: 124,902,572 Y358F Het
Ermp1 A T 19: 29,612,654 M853K probably benign Het
Hace1 T G 10: 45,700,979 I823S probably benign Het
Hectd3 A T 4: 116,996,588 Y227F probably benign Het
Hells A G 19: 38,957,057 N580S probably benign Het
Igkv12-44 A G 6: 69,814,734 F82L probably damaging Het
Inpp5d A G 1: 87,695,400 D405G probably damaging Het
Itsn2 G A 12: 4,708,198 R1508H probably benign Het
Limk1 A T 5: 134,657,971 probably null Het
Lingo1 T A 9: 56,620,883 K147* probably null Het
Ltn1 T C 16: 87,397,899 S1371G probably benign Het
Mab21l1 A G 3: 55,783,886 D298G possibly damaging Het
Macf1 A T 4: 123,472,289 V2893E probably benign Het
Mapk8ip1 T C 2: 92,389,144 D114G probably benign Het
Med15 A T 16: 17,722,865 W6R probably benign Het
Mrps34 T C 17: 24,895,457 L97P probably damaging Het
Myrfl A T 10: 116,861,512 F36I possibly damaging Het
Nifk G A 1: 118,332,474 S253N probably damaging Het
Nmnat1 T A 4: 149,473,301 T95S probably damaging Het
Oasl1 T A 5: 114,935,926 I298N probably damaging Het
Odf3l1 C T 9: 56,852,499 probably null Het
Olfr570 A G 7: 102,900,553 Y62C probably benign Het
Olfr689 T G 7: 105,314,505 L167R probably damaging Het
Olfr970 A T 9: 39,820,127 M163L probably benign Het
Polr2b C T 5: 77,321,066 R230* probably null Het
Prkra T A 2: 76,647,201 E53D probably benign Het
Rasgrp4 T A 7: 29,145,980 L376Q probably damaging Het
Rwdd3 A G 3: 121,171,312 S65P probably benign Het
Satb1 G A 17: 51,783,001 P273S probably damaging Het
Scg3 T C 9: 75,682,092 E93G probably damaging Het
Sf3a1 T C 11: 4,167,724 F162S possibly damaging Het
Sorcs1 A G 19: 50,262,263 Y377H probably damaging Het
Sptbn4 G A 7: 27,409,014 A661V possibly damaging Het
Stk36 A G 1: 74,634,320 N996S unknown Het
Tbca A T 13: 94,832,415 I37F probably damaging Het
Tc2n A T 12: 101,706,457 V75E probably damaging Het
Tdrkh A T 3: 94,425,956 S243C probably damaging Het
Tjp1 T C 7: 65,314,690 D911G probably damaging Het
Tmbim6 A G 15: 99,401,443 probably benign Het
Ttpal T A 2: 163,607,025 probably null Het
Usp37 A T 1: 74,495,628 probably null Het
Vmn1r235 A G 17: 21,262,396 I328V probably benign Het
Vmn1r28 T A 6: 58,265,865 L231* probably null Het
Xirp1 G A 9: 120,019,110 Q236* probably null Het
Zc3h7b A G 15: 81,780,481 T514A probably damaging Het
Zfp524 A G 7: 5,018,201 I243V probably benign Het
Zfp655 T A 5: 145,244,732 Y467N possibly damaging Het
Zfp985 A T 4: 147,582,931 K85N possibly damaging Het
Other mutations in Tob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Tob1 APN 11 94214055 missense probably damaging 1.00
IGL02028:Tob1 APN 11 94214226 missense probably benign 0.43
IGL02866:Tob1 APN 11 94214057 missense possibly damaging 0.87
FR4304:Tob1 UTSW 11 94214464 small insertion probably benign
FR4304:Tob1 UTSW 11 94214477 nonsense probably null
FR4340:Tob1 UTSW 11 94214454 small insertion probably benign
FR4340:Tob1 UTSW 11 94214460 small insertion probably benign
FR4340:Tob1 UTSW 11 94214477 small insertion probably benign
FR4342:Tob1 UTSW 11 94214472 small insertion probably benign
FR4449:Tob1 UTSW 11 94214468 small insertion probably benign
FR4449:Tob1 UTSW 11 94214475 small insertion probably benign
FR4548:Tob1 UTSW 11 94214455 small insertion probably benign
FR4548:Tob1 UTSW 11 94214469 small insertion probably benign
FR4589:Tob1 UTSW 11 94214451 small insertion probably benign
FR4589:Tob1 UTSW 11 94214477 frame shift probably null
FR4737:Tob1 UTSW 11 94214451 small insertion probably benign
FR4737:Tob1 UTSW 11 94214464 small insertion probably benign
FR4737:Tob1 UTSW 11 94214478 small insertion probably benign
FR4976:Tob1 UTSW 11 94214472 small insertion probably benign
R0142:Tob1 UTSW 11 94214597 missense probably damaging 1.00
R1777:Tob1 UTSW 11 94213754 missense probably damaging 1.00
R4213:Tob1 UTSW 11 94214192 missense probably damaging 1.00
R4280:Tob1 UTSW 11 94214322 missense probably benign
R4537:Tob1 UTSW 11 94214452 small deletion probably benign
R4899:Tob1 UTSW 11 94214452 small deletion probably benign
R5074:Tob1 UTSW 11 94213741 missense possibly damaging 0.88
R5502:Tob1 UTSW 11 94214452 small deletion probably benign
R5828:Tob1 UTSW 11 94213757 missense probably damaging 1.00
R5828:Tob1 UTSW 11 94213759 nonsense probably null
R7839:Tob1 UTSW 11 94213772 missense probably damaging 1.00
R7922:Tob1 UTSW 11 94213772 missense probably damaging 1.00
RF028:Tob1 UTSW 11 94214451 small insertion probably benign
RF041:Tob1 UTSW 11 94214451 small insertion probably benign
RF042:Tob1 UTSW 11 94214451 small insertion probably benign
RF044:Tob1 UTSW 11 94214461 small insertion probably benign
RF054:Tob1 UTSW 11 94214461 small insertion probably benign
Z1177:Tob1 UTSW 11 94213992 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TAACTTTTGTGGCTTCGCAGC -3'
(R):5'- TTATGGGCATGAACACCTGG -3'

Sequencing Primer
(F):5'- CCCAGGAGACGTGTCAACATTTTTG -3'
(R):5'- TGGGCCTCCGGGTTAAAG -3'
Posted On2019-10-07