Incidental Mutation 'R7471:Apoh'
ID 579213
Institutional Source Beutler Lab
Gene Symbol Apoh
Ensembl Gene ENSMUSG00000000049
Gene Name apolipoprotein H
Synonyms beta-2-GPI, beta-2-glycoprotein 1, B2GPI
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock # R7471 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 108343354-108414396 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108407305 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 144 (P144S)
Ref Sequence ENSEMBL: ENSMUSP00000000049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000049] [ENSMUST00000152958]
AlphaFold Q01339
Predicted Effect probably damaging
Transcript: ENSMUST00000000049
AA Change: P144S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000049
Gene: ENSMUSG00000000049
AA Change: P144S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
CCP 142 200 4.92e-10 SMART
CCP 205 260 1.98e-14 SMART
CCP 264 325 2.51e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152958
AA Change: P144S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114214
Gene: ENSMUSG00000000049
AA Change: P144S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced viability and reduced thrombin production. Only 8% homozygous null animals are born from heterozygous intercrosses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A C 19: 29,729,739 probably null Het
Acaca T A 11: 84,277,782 probably null Het
Ace T C 11: 105,973,482 V483A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Angptl2 A T 2: 33,243,739 T358S possibly damaging Het
Arid1a A G 4: 133,681,044 W1666R unknown Het
Asap3 A G 4: 136,233,646 H223R possibly damaging Het
Bcl2l12 A G 7: 44,996,553 S81P possibly damaging Het
C8a A G 4: 104,817,625 S550P probably benign Het
Cacna2d1 C G 5: 15,934,975 probably benign Het
Ccdc170 A G 10: 4,520,803 T216A probably benign Het
Chd7 A T 4: 8,859,197 K2429I probably damaging Het
Chd8 T C 14: 52,204,112 N2181S probably benign Het
Clip3 T C 7: 30,301,952 V342A possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Cyp20a1 T C 1: 60,354,640 F139S probably damaging Het
Dclre1b T A 3: 103,803,114 R494W probably benign Het
Dicer1 A G 12: 104,694,710 I1695T probably damaging Het
Dnah7a A G 1: 53,419,699 L3760P probably damaging Het
Dock1 A G 7: 135,163,343 D1688G possibly damaging Het
Drosha G A 15: 12,889,656 R870Q probably damaging Het
Dsg2 G T 18: 20,580,618 M215I probably benign Het
Dst A T 1: 34,194,570 D3453V possibly damaging Het
Epha10 A T 4: 124,902,572 Y358F Het
Ermp1 A T 19: 29,612,654 M853K probably benign Het
Hace1 T G 10: 45,700,979 I823S probably benign Het
Hectd3 A T 4: 116,996,588 Y227F probably benign Het
Hells A G 19: 38,957,057 N580S probably benign Het
Igkv12-44 A G 6: 69,814,734 F82L probably damaging Het
Inpp5d A G 1: 87,695,400 D405G probably damaging Het
Itsn2 G A 12: 4,708,198 R1508H probably benign Het
Limk1 A T 5: 134,657,971 probably null Het
Lingo1 T A 9: 56,620,883 K147* probably null Het
Ltn1 T C 16: 87,397,899 S1371G probably benign Het
Mab21l1 A G 3: 55,783,886 D298G possibly damaging Het
Macf1 A T 4: 123,472,289 V2893E probably benign Het
Mapk8ip1 T C 2: 92,389,144 D114G probably benign Het
Med15 A T 16: 17,722,865 W6R probably benign Het
Mrps34 T C 17: 24,895,457 L97P probably damaging Het
Myrfl A T 10: 116,861,512 F36I possibly damaging Het
Nifk G A 1: 118,332,474 S253N probably damaging Het
Nmnat1 T A 4: 149,473,301 T95S probably damaging Het
Oasl1 T A 5: 114,935,926 I298N probably damaging Het
Odf3l1 C T 9: 56,852,499 probably null Het
Olfr570 A G 7: 102,900,553 Y62C probably benign Het
Olfr689 T G 7: 105,314,505 L167R probably damaging Het
Olfr970 A T 9: 39,820,127 M163L probably benign Het
Polr2b C T 5: 77,321,066 R230* probably null Het
Prkra T A 2: 76,647,201 E53D probably benign Het
Rasgrp4 T A 7: 29,145,980 L376Q probably damaging Het
Rwdd3 A G 3: 121,171,312 S65P probably benign Het
Satb1 G A 17: 51,783,001 P273S probably damaging Het
Scg3 T C 9: 75,682,092 E93G probably damaging Het
Sf3a1 T C 11: 4,167,724 F162S possibly damaging Het
Sorcs1 A G 19: 50,262,263 Y377H probably damaging Het
Sptbn4 G A 7: 27,409,014 A661V possibly damaging Het
Stk36 A G 1: 74,634,320 N996S unknown Het
Tbca A T 13: 94,832,415 I37F probably damaging Het
Tc2n A T 12: 101,706,457 V75E probably damaging Het
Tdrkh A T 3: 94,425,956 S243C probably damaging Het
Tjp1 T C 7: 65,314,690 D911G probably damaging Het
Tmbim6 A G 15: 99,401,443 probably benign Het
Tob1 T A 11: 94,213,882 D81E probably benign Het
Ttpal T A 2: 163,607,025 probably null Het
Usp37 A T 1: 74,495,628 probably null Het
Vmn1r235 A G 17: 21,262,396 I328V probably benign Het
Vmn1r28 T A 6: 58,265,865 L231* probably null Het
Xirp1 G A 9: 120,019,110 Q236* probably null Het
Zc3h7b A G 15: 81,780,481 T514A probably damaging Het
Zfp524 A G 7: 5,018,201 I243V probably benign Het
Zfp655 T A 5: 145,244,732 Y467N possibly damaging Het
Zfp985 A T 4: 147,582,931 K85N possibly damaging Het
Other mutations in Apoh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Apoh APN 11 108395834 missense probably benign 0.45
IGL01327:Apoh APN 11 108397361 missense probably damaging 1.00
IGL01353:Apoh APN 11 108397385 missense probably damaging 1.00
IGL01464:Apoh APN 11 108395890 missense probably damaging 1.00
IGL02065:Apoh APN 11 108414305 utr 3 prime probably benign
IGL02646:Apoh APN 11 108412142 missense probably benign 0.15
R0125:Apoh UTSW 11 108412073 missense probably damaging 1.00
R0359:Apoh UTSW 11 108397373 missense probably damaging 1.00
R1969:Apoh UTSW 11 108407462 missense probably benign 0.00
R2280:Apoh UTSW 11 108409180 nonsense probably null
R2568:Apoh UTSW 11 108404871 missense probably benign 0.00
R4369:Apoh UTSW 11 108397379 missense probably damaging 1.00
R4789:Apoh UTSW 11 108409238 missense probably damaging 1.00
R4824:Apoh UTSW 11 108414261 missense probably benign 0.37
R4937:Apoh UTSW 11 108407378 missense probably benign 0.19
R5634:Apoh UTSW 11 108412049 missense probably damaging 1.00
R5900:Apoh UTSW 11 108412017 missense probably damaging 0.99
R5951:Apoh UTSW 11 108395903 missense probably damaging 1.00
R6054:Apoh UTSW 11 108395975 missense probably damaging 1.00
R6126:Apoh UTSW 11 108397373 missense probably damaging 1.00
R7343:Apoh UTSW 11 108395848 missense probably benign 0.14
R8557:Apoh UTSW 11 108409236 missense probably damaging 0.99
R9310:Apoh UTSW 11 108407481 critical splice donor site probably null
R9671:Apoh UTSW 11 108395966 nonsense probably null
X0065:Apoh UTSW 11 108395350 missense probably damaging 1.00
Z1176:Apoh UTSW 11 108343459 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCGTTCTGAGATGAGTGTATTTTAGC -3'
(R):5'- ATTCTGGCAATCGGGTCC -3'

Sequencing Primer
(F):5'- TGTGTAGAGGTCCAAAGATCATC -3'
(R):5'- CTGGCAATCGGGTCCAGTTTC -3'
Posted On 2019-10-07