Incidental Mutation 'R7471:Tc2n'
ID579215
Institutional Source Beutler Lab
Gene Symbol Tc2n
Ensembl Gene ENSMUSG00000021187
Gene Nametandem C2 domains, nuclear
Synonyms4933406D09Rik, Tac2-N, Mtac2d1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7471 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101645443-101718523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101706457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 75 (V75E)
Ref Sequence ENSEMBL: ENSMUSP00000125288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110047] [ENSMUST00000160715] [ENSMUST00000160830] [ENSMUST00000162735]
Predicted Effect probably damaging
Transcript: ENSMUST00000110047
AA Change: V75E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105674
Gene: ENSMUSG00000021187
AA Change: V75E

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160715
AA Change: V75E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125099
Gene: ENSMUSG00000021187
AA Change: V75E

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
Blast:C2 238 287 1e-24 BLAST
C2 302 408 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160830
AA Change: V75E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124287
Gene: ENSMUSG00000021187
AA Change: V75E

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162735
AA Change: V75E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125288
Gene: ENSMUSG00000021187
AA Change: V75E

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
low complexity region 190 210 N/A INTRINSIC
C2 238 339 5.56e0 SMART
C2 366 472 1.02e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace T C 11: 105,973,482 V483A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Angptl2 A T 2: 33,243,739 T358S possibly damaging Het
Apoh C T 11: 108,407,305 P144S probably damaging Het
Arid1a A G 4: 133,681,044 W1666R unknown Het
Asap3 A G 4: 136,233,646 H223R possibly damaging Het
Bcl2l12 A G 7: 44,996,553 S81P possibly damaging Het
C8a A G 4: 104,817,625 S550P probably benign Het
Cacna2d1 C G 5: 15,934,975 probably benign Het
Ccdc170 A G 10: 4,520,803 T216A probably benign Het
Chd7 A T 4: 8,859,197 K2429I probably damaging Het
Chd8 T C 14: 52,204,112 N2181S probably benign Het
Clip3 T C 7: 30,301,952 V342A possibly damaging Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Cyp20a1 T C 1: 60,354,640 F139S probably damaging Het
Dclre1b T A 3: 103,803,114 R494W probably benign Het
Dicer1 A G 12: 104,694,710 I1695T probably damaging Het
Dnah7a A G 1: 53,419,699 L3760P probably damaging Het
Dock1 A G 7: 135,163,343 D1688G possibly damaging Het
Drosha G A 15: 12,889,656 R870Q probably damaging Het
Dsg2 G T 18: 20,580,618 M215I probably benign Het
Dst A T 1: 34,194,570 D3453V possibly damaging Het
Epha10 A T 4: 124,902,572 Y358F Het
Ermp1 A T 19: 29,612,654 M853K probably benign Het
Hace1 T G 10: 45,700,979 I823S probably benign Het
Hectd3 A T 4: 116,996,588 Y227F probably benign Het
Hells A G 19: 38,957,057 N580S probably benign Het
Igkv12-44 A G 6: 69,814,734 F82L probably damaging Het
Inpp5d A G 1: 87,695,400 D405G probably damaging Het
Itsn2 G A 12: 4,708,198 R1508H probably benign Het
Lingo1 T A 9: 56,620,883 K147* probably null Het
Ltn1 T C 16: 87,397,899 S1371G probably benign Het
Mab21l1 A G 3: 55,783,886 D298G possibly damaging Het
Macf1 A T 4: 123,472,289 V2893E probably benign Het
Mapk8ip1 T C 2: 92,389,144 D114G probably benign Het
Med15 A T 16: 17,722,865 W6R probably benign Het
Mrps34 T C 17: 24,895,457 L97P probably damaging Het
Myrfl A T 10: 116,861,512 F36I possibly damaging Het
Nifk G A 1: 118,332,474 S253N probably damaging Het
Nmnat1 T A 4: 149,473,301 T95S probably damaging Het
Oasl1 T A 5: 114,935,926 I298N probably damaging Het
Odf3l1 C T 9: 56,852,499 probably null Het
Olfr570 A G 7: 102,900,553 Y62C probably benign Het
Olfr689 T G 7: 105,314,505 L167R probably damaging Het
Olfr970 A T 9: 39,820,127 M163L probably benign Het
Polr2b C T 5: 77,321,066 R230* probably null Het
Prkra T A 2: 76,647,201 E53D probably benign Het
Rasgrp4 T A 7: 29,145,980 L376Q probably damaging Het
Rwdd3 A G 3: 121,171,312 S65P probably benign Het
Satb1 G A 17: 51,783,001 P273S probably damaging Het
Scg3 T C 9: 75,682,092 E93G probably damaging Het
Sf3a1 T C 11: 4,167,724 F162S possibly damaging Het
Sorcs1 A G 19: 50,262,263 Y377H probably damaging Het
Sptbn4 G A 7: 27,409,014 A661V possibly damaging Het
Stk36 A G 1: 74,634,320 N996S unknown Het
Tbca A T 13: 94,832,415 I37F probably damaging Het
Tdrkh A T 3: 94,425,956 S243C probably damaging Het
Tjp1 T C 7: 65,314,690 D911G probably damaging Het
Tob1 T A 11: 94,213,882 D81E probably benign Het
Usp37 A T 1: 74,495,628 probably null Het
Vmn1r235 A G 17: 21,262,396 I328V probably benign Het
Vmn1r28 T A 6: 58,265,865 L231* probably null Het
Xirp1 G A 9: 120,019,110 Q236* probably null Het
Zc3h7b A G 15: 81,780,481 T514A probably damaging Het
Zfp524 A G 7: 5,018,201 I243V probably benign Het
Zfp655 T A 5: 145,244,732 Y467N possibly damaging Het
Zfp985 A T 4: 147,582,931 K85N possibly damaging Het
Other mutations in Tc2n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tc2n APN 12 101649089 utr 3 prime probably benign
IGL02129:Tc2n APN 12 101689789 missense probably damaging 0.99
IGL02630:Tc2n APN 12 101693145 missense probably damaging 0.99
R0517:Tc2n UTSW 12 101649195 missense probably damaging 0.98
R0980:Tc2n UTSW 12 101678576 nonsense probably null
R1676:Tc2n UTSW 12 101688992 missense probably damaging 1.00
R2187:Tc2n UTSW 12 101706544 missense probably damaging 1.00
R3771:Tc2n UTSW 12 101694574 missense possibly damaging 0.68
R4082:Tc2n UTSW 12 101651155 missense possibly damaging 0.85
R4180:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R4707:Tc2n UTSW 12 101694573 missense probably benign 0.16
R4793:Tc2n UTSW 12 101651117 missense possibly damaging 0.86
R4917:Tc2n UTSW 12 101665695 missense probably damaging 1.00
R5214:Tc2n UTSW 12 101693202 nonsense probably null
R5870:Tc2n UTSW 12 101652852 missense probably damaging 1.00
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6034:Tc2n UTSW 12 101651201 splice site probably null
R6128:Tc2n UTSW 12 101709489 start codon destroyed probably null 0.99
R7200:Tc2n UTSW 12 101689055 missense probably damaging 1.00
R7469:Tc2n UTSW 12 101665675 missense probably damaging 1.00
R7730:Tc2n UTSW 12 101651147 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCACAGGCATCCAAATGTATG -3'
(R):5'- TAAAAGTTCCAGCCATTTTGGG -3'

Sequencing Primer
(F):5'- CAGGCATCCAAATGTATGTGGTATAC -3'
(R):5'- TGGTATCCCTCCATTGAC -3'
Posted On2019-10-07