Incidental Mutation 'R7473:Dnah14'
ID 579240
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 045547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7473 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181579704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 3079 (H3079R)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: H3079R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.1723 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 89,965,960 (GRCm39) probably null Het
A630095N17Rik G A 1: 75,208,675 (GRCm39) T15I unknown Het
Actr1b A G 1: 36,748,900 (GRCm39) V12A probably benign Het
Add1 A G 5: 34,776,697 (GRCm39) T473A possibly damaging Het
Akap11 A T 14: 78,751,328 (GRCm39) V353E Het
Alcam G A 16: 52,272,882 (GRCm39) probably benign Het
Alpi A G 1: 87,027,369 (GRCm39) probably null Het
Ap3s2 A G 7: 79,565,779 (GRCm39) F49S probably damaging Het
Arpc1a A G 5: 145,037,886 (GRCm39) K174E probably benign Het
Bbox1 A T 2: 110,095,843 (GRCm39) S374T probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bltp2 T C 11: 78,157,941 (GRCm39) S368P possibly damaging Het
Bmp2k A G 5: 97,204,871 (GRCm39) N402S probably benign Het
Bmper C A 9: 23,286,926 (GRCm39) A284D probably benign Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Bpifb2 A T 2: 153,723,116 (GRCm39) H124L possibly damaging Het
Bsn C T 9: 107,989,449 (GRCm39) R2101Q probably damaging Het
Cacng1 T A 11: 107,607,018 (GRCm39) D67V probably damaging Het
Catsperg1 A G 7: 28,894,903 (GRCm39) S565P probably damaging Het
Cep126 C T 9: 8,101,779 (GRCm39) E252K probably damaging Het
Cep55 G A 19: 38,058,384 (GRCm39) E326K probably damaging Het
Cfap58 T A 19: 47,963,064 (GRCm39) Y491* probably null Het
Cpeb2 T C 5: 43,434,848 (GRCm39) S747P Het
Cryz T A 3: 154,312,157 (GRCm39) S85T probably benign Het
D2hgdh T C 1: 93,765,800 (GRCm39) V367A probably damaging Het
Dgkh T C 14: 78,836,483 (GRCm39) N703S probably benign Het
Dnah11 T C 12: 117,866,911 (GRCm39) S4077G probably benign Het
Dnah2 T A 11: 69,382,484 (GRCm39) T1209S probably damaging Het
Dnmt3b A G 2: 153,526,370 (GRCm39) D804G probably damaging Het
Ell2 A G 13: 75,898,154 (GRCm39) E143G probably damaging Het
Exoc2 A G 13: 31,006,613 (GRCm39) probably null Het
Fahd2a A T 2: 127,282,376 (GRCm39) I131N probably damaging Het
Fer1l5 A G 1: 36,460,689 (GRCm39) N1976D possibly damaging Het
Flt1 A G 5: 147,531,405 (GRCm39) S853P probably damaging Het
Frg2f1 C T 4: 119,387,990 (GRCm39) V170I probably benign Het
Gcn1 G A 5: 115,719,863 (GRCm39) V373M probably benign Het
Gm19965 A G 1: 116,749,602 (GRCm39) T428A unknown Het
Gm4792 A G 10: 94,129,730 (GRCm39) I124T unknown Het
Grik2 A T 10: 48,989,618 (GRCm39) C804S probably benign Het
Heatr6 T A 11: 83,672,217 (GRCm39) I1075N probably damaging Het
Hunk G A 16: 90,250,588 (GRCm39) A211T probably damaging Het
Ighe T C 12: 113,234,976 (GRCm39) I395V probably damaging Het
Ino80e A T 7: 126,456,484 (GRCm39) S104T probably damaging Het
Inpp4a A G 1: 37,408,534 (GRCm39) Y305C probably benign Het
Insrr T A 3: 87,711,838 (GRCm39) probably null Het
Itgae T G 11: 73,031,504 (GRCm39) D1073E possibly damaging Het
Klf11 G T 12: 24,705,141 (GRCm39) probably null Het
Lrguk A T 6: 34,006,630 (GRCm39) K80M probably benign Het
Map2 A T 1: 66,454,617 (GRCm39) D1169V probably damaging Het
Mpst G T 15: 78,297,726 (GRCm39) C248F probably damaging Het
Myo9a C A 9: 59,802,527 (GRCm39) Q2005K probably benign Het
Nfatc4 C T 14: 56,069,421 (GRCm39) T649I probably benign Het
Nmt1 A G 11: 102,937,226 (GRCm39) R88G probably benign Het
Nqo1 G A 8: 108,129,729 (GRCm39) probably benign Het
Nudt2 T G 4: 41,477,576 (GRCm39) M19R probably benign Het
Or10a49 T A 7: 108,467,476 (GRCm39) K295M probably damaging Het
Or12d2 T A 17: 37,624,522 (GRCm39) Y251F probably benign Het
Or9q2 C T 19: 13,772,526 (GRCm39) V150M probably benign Het
P2ry1 T A 3: 60,911,509 (GRCm39) I216N probably damaging Het
Pcx T A 19: 4,669,589 (GRCm39) L823* probably null Het
Pkhd1 A G 1: 20,619,980 (GRCm39) V880A probably damaging Het
Plcb1 A T 2: 135,186,196 (GRCm39) N721I probably damaging Het
Prdm15 T C 16: 97,623,046 (GRCm39) K269E possibly damaging Het
Prl7b1 A G 13: 27,785,996 (GRCm39) V224A possibly damaging Het
Reln A G 5: 22,134,125 (GRCm39) V2601A probably benign Het
Rspo4 G A 2: 151,714,993 (GRCm39) R210Q unknown Het
Slc7a5 A T 8: 122,615,162 (GRCm39) D228E probably benign Het
Spopfm2 T A 3: 94,083,509 (GRCm39) K101* probably null Het
Tas2r115 A G 6: 132,714,214 (GRCm39) S246P probably damaging Het
Tenm4 A G 7: 96,423,353 (GRCm39) Y716C probably damaging Het
Tgfb3 T C 12: 86,108,923 (GRCm39) K269E possibly damaging Het
Thoc6 A G 17: 23,889,841 (GRCm39) I27T probably benign Het
Tigd5 G A 15: 75,781,748 (GRCm39) G37S probably benign Het
Tmem259 C T 10: 79,815,506 (GRCm39) D102N possibly damaging Het
Tpo T G 12: 30,142,589 (GRCm39) I712L probably benign Het
Ttn G A 2: 76,700,892 (GRCm39) T21M possibly damaging Het
Utp20 A T 10: 88,656,572 (GRCm39) probably null Het
Xrcc5 A G 1: 72,351,748 (GRCm39) D106G probably damaging Het
Xrn1 T A 9: 95,861,194 (GRCm39) F451L probably benign Het
Zar1l T A 5: 150,441,203 (GRCm39) D141V probably damaging Het
Zfp27 A T 7: 29,595,324 (GRCm39) C214S possibly damaging Het
Znfx1 A T 2: 166,880,744 (GRCm39) C1211S probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTGACACATTCTCCCTAACG -3'
(R):5'- AGCATTGAGTCTAGGCGAATG -3'

Sequencing Primer
(F):5'- ACGTGCATCTCATGTGACATG -3'
(R):5'- CATTGAGTCTAGGCGAATGAGCATG -3'
Posted On 2019-10-07