Incidental Mutation 'R7473:Dnah14'
ID 579240
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms Dnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7473 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181576559-181815774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181752139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 3079 (H3079R)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: H3079R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.1723 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,267,115 S368P possibly damaging Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933434E20Rik T C 3: 90,058,653 probably null Het
A630095N17Rik G A 1: 75,232,031 T15I unknown Het
Actr1b A G 1: 36,709,819 V12A probably benign Het
Add1 A G 5: 34,619,353 T473A possibly damaging Het
Akap11 A T 14: 78,513,888 V353E Het
Alcam G A 16: 52,452,519 probably benign Het
Alpi A G 1: 87,099,647 probably null Het
Ap3s2 A G 7: 79,916,031 F49S probably damaging Het
Arpc1a A G 5: 145,101,076 K174E probably benign Het
Bbox1 A T 2: 110,265,498 S374T probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bmp2k A G 5: 97,057,012 N402S probably benign Het
Bmper C A 9: 23,375,630 A284D probably benign Het
Bpifb2 A T 2: 153,881,196 H124L possibly damaging Het
Bsn C T 9: 108,112,250 R2101Q probably damaging Het
Cacng1 T A 11: 107,716,192 D67V probably damaging Het
Catsperg1 A G 7: 29,195,478 S565P probably damaging Het
Cep126 C T 9: 8,101,778 E252K probably damaging Het
Cep55 G A 19: 38,069,936 E326K probably damaging Het
Cfap58 T A 19: 47,974,625 Y491* probably null Het
Cpeb2 T C 5: 43,277,505 S747P Het
Cryz T A 3: 154,606,520 S85T probably benign Het
D2hgdh T C 1: 93,838,078 V367A probably damaging Het
Dgkh T C 14: 78,599,043 N703S probably benign Het
Dnah11 T C 12: 117,903,176 S4077G probably benign Het
Dnah2 T A 11: 69,491,658 T1209S probably damaging Het
Dnmt3b A G 2: 153,684,450 D804G probably damaging Het
Ell2 A G 13: 75,750,035 E143G probably damaging Het
Exoc2 A G 13: 30,822,630 probably null Het
Fahd2a A T 2: 127,440,456 I131N probably damaging Het
Fer1l5 A G 1: 36,421,608 N1976D possibly damaging Het
Flt1 A G 5: 147,594,595 S853P probably damaging Het
Frg2f1 C T 4: 119,530,793 V170I probably benign Het
Gcn1l1 G A 5: 115,581,804 V373M probably benign Het
Gm10696 T A 3: 94,176,202 K101* probably null Het
Gm19965 A G 1: 116,821,872 T428A unknown Het
Gm4792 A G 10: 94,293,868 I124T unknown Het
Grik2 A T 10: 49,113,522 C804S probably benign Het
Heatr6 T A 11: 83,781,391 I1075N probably damaging Het
Hunk G A 16: 90,453,700 A211T probably damaging Het
Ighe T C 12: 113,271,356 I395V probably damaging Het
Ino80e A T 7: 126,857,312 S104T probably damaging Het
Inpp4a A G 1: 37,369,453 Y305C probably benign Het
Insrr T A 3: 87,804,531 probably null Het
Itgae T G 11: 73,140,678 D1073E possibly damaging Het
Klf11 G T 12: 24,655,142 probably null Het
Lrguk A T 6: 34,029,695 K80M probably benign Het
Map2 A T 1: 66,415,458 D1169V probably damaging Het
Mpst G T 15: 78,413,526 C248F probably damaging Het
Myo9a C A 9: 59,895,244 Q2005K probably benign Het
Nfatc4 C T 14: 55,831,964 T649I probably benign Het
Nmt1 A G 11: 103,046,400 R88G probably benign Het
Nqo1 G A 8: 107,403,097 probably benign Het
Nudt2 T G 4: 41,477,576 M19R probably benign Het
Olfr102 T A 17: 37,313,631 Y251F probably benign Het
Olfr1497 C T 19: 13,795,162 V150M probably benign Het
Olfr517 T A 7: 108,868,269 K295M probably damaging Het
P2ry1 T A 3: 61,004,088 I216N probably damaging Het
Pcx T A 19: 4,619,561 L823* probably null Het
Pkhd1 A G 1: 20,549,756 V880A probably damaging Het
Plcb1 A T 2: 135,344,276 N721I probably damaging Het
Prdm15 T C 16: 97,821,846 K269E possibly damaging Het
Prl7b1 A G 13: 27,602,013 V224A possibly damaging Het
Reln A G 5: 21,929,127 V2601A probably benign Het
Rspo4 G A 2: 151,873,073 R210Q unknown Het
Slc7a5 A T 8: 121,888,423 D228E probably benign Het
Tas2r115 A G 6: 132,737,251 S246P probably damaging Het
Tenm4 A G 7: 96,774,146 Y716C probably damaging Het
Tgfb3 T C 12: 86,062,149 K269E possibly damaging Het
Thoc6 A G 17: 23,670,867 I27T probably benign Het
Tigd5 G A 15: 75,909,899 G37S probably benign Het
Tmem259 C T 10: 79,979,672 D102N possibly damaging Het
Tpo T G 12: 30,092,590 I712L probably benign Het
Ttn G A 2: 76,870,548 T21M possibly damaging Het
Utp20 A T 10: 88,820,710 probably null Het
Xrcc5 A G 1: 72,312,589 D106G probably damaging Het
Xrn1 T A 9: 95,979,141 F451L probably benign Het
Zar1l T A 5: 150,517,738 D141V probably damaging Het
Zfp27 A T 7: 29,895,899 C214S possibly damaging Het
Znfx1 A T 2: 167,038,824 C1211S probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
R8520:Dnah14 UTSW 1 181653638 missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181664946 missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181666011 nonsense probably null
R8710:Dnah14 UTSW 1 181690311 missense probably benign 0.04
R8752:Dnah14 UTSW 1 181628016 missense probably benign 0.00
R8792:Dnah14 UTSW 1 181814624 missense
R8797:Dnah14 UTSW 1 181637847 missense probably benign 0.19
R8821:Dnah14 UTSW 1 181792004 nonsense probably null
R8834:Dnah14 UTSW 1 181616750 missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181725498 missense probably benign 0.01
R8925:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181622723 missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9169:Dnah14 UTSW 1 181605816 missense probably benign 0.06
R9199:Dnah14 UTSW 1 181651001 missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181801287 missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181616640 critical splice donor site probably null
R9271:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9282:Dnah14 UTSW 1 181814512 missense
R9350:Dnah14 UTSW 1 181734804 missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181709033 missense probably benign 0.01
R9436:Dnah14 UTSW 1 181680783 missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181690208 missense probably benign 0.45
R9484:Dnah14 UTSW 1 181797746 missense probably benign 0.01
R9486:Dnah14 UTSW 1 181680929 missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181674442 missense probably benign 0.16
R9654:Dnah14 UTSW 1 181766339 missense probably benign 0.01
R9681:Dnah14 UTSW 1 181734849 missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181598944 missense probably benign 0.01
R9687:Dnah14 UTSW 1 181598413 missense probably benign 0.01
R9718:Dnah14 UTSW 1 181622979 missense probably benign 0.08
R9751:Dnah14 UTSW 1 181792045 missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181685784 missense probably benign 0.03
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTGACACATTCTCCCTAACG -3'
(R):5'- AGCATTGAGTCTAGGCGAATG -3'

Sequencing Primer
(F):5'- ACGTGCATCTCATGTGACATG -3'
(R):5'- CATTGAGTCTAGGCGAATGAGCATG -3'
Posted On 2019-10-07