Incidental Mutation 'R0631:Whrn'
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Namewhirlin
SynonymsC430046P22Rik, Dfnb31, wi, 1110035G07Rik
MMRRC Submission 038820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0631 (G1)
Quality Score225
Status Validated
Chromosomal Location63414910-63495991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63419489 bp
Amino Acid Change Threonine to Isoleucine at position 545 (T545I)
Ref Sequence ENSEMBL: ENSMUSP00000069664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
Predicted Effect probably damaging
Transcript: ENSMUST00000063650
AA Change: T545I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: T545I

low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084510
AA Change: T556I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: T556I

low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
AA Change: T42I

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137
AA Change: T42I

low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095038
AA Change: T114I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137
AA Change: T114I

low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102867
AA Change: T545I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: T545I

low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
AA Change: T549I

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: T549I

low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
AA Change: T103I

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137
AA Change: T103I

low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Meta Mutation Damage Score 0.2109 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T A 9: 51,101,953 R6S probably benign Het
Aadat T C 8: 60,529,445 probably benign Het
Afap1l2 T C 19: 56,916,085 E594G probably benign Het
Ak8 T G 2: 28,735,665 I240S probably damaging Het
Akap13 T C 7: 75,614,996 V174A probably damaging Het
Alppl2 G A 1: 87,089,373 T66I probably damaging Het
Ankrd61 T A 5: 143,894,879 I36F probably damaging Het
Antxrl T A 14: 34,058,801 probably null Het
Arhgef2 G C 3: 88,634,436 V244L probably damaging Het
Arid1a A G 4: 133,689,170 I1098T unknown Het
Atr T C 9: 95,874,777 V903A possibly damaging Het
AW549877 A G 15: 3,986,489 probably benign Het
B3gnt6 C A 7: 98,193,692 A354S probably benign Het
Bnc1 A T 7: 81,974,366 I371N probably damaging Het
Camsap1 A T 2: 25,933,647 S1464T probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Cass4 T C 2: 172,432,411 I728T probably damaging Het
Ccdc88a A T 11: 29,493,752 M1378L probably damaging Het
Ccdc9 C A 7: 16,278,459 W266L probably damaging Het
Cct6b C A 11: 82,737,088 probably null Het
Cd177 T C 7: 24,756,686 E219G probably benign Het
Cdkal1 A T 13: 29,354,684 Y497* probably null Het
Chmp2a T C 7: 13,032,444 E107G probably damaging Het
Chrna2 T G 14: 66,149,308 V301G probably benign Het
Chrna7 A G 7: 63,099,643 C364R probably benign Het
Cltc G T 11: 86,712,613 L796I probably benign Het
Col12a1 T C 9: 79,703,376 T249A probably damaging Het
Col13a1 G A 10: 61,887,350 Q270* probably null Het
Col6a1 C T 10: 76,709,735 V968M probably benign Het
Copb1 C A 7: 114,233,282 V511F probably benign Het
Daw1 C G 1: 83,197,260 S160R probably damaging Het
Ddx46 A G 13: 55,639,777 probably benign Het
Depdc7 T C 2: 104,721,987 K492E possibly damaging Het
Dmbt1 C T 7: 131,097,653 A1004V possibly damaging Het
Dnah7b G A 1: 46,240,992 V2694I probably benign Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Edc4 C A 8: 105,890,792 A1052E possibly damaging Het
Eif2s2 T A 2: 154,884,358 K129M probably damaging Het
Emx2 A G 19: 59,464,028 D248G probably damaging Het
Erich6b T C 14: 75,659,009 probably benign Het
Exoc3l4 A G 12: 111,427,966 K507E probably benign Het
Fanci T A 7: 79,406,205 V195E probably damaging Het
Fgfr2 T G 7: 130,227,239 probably benign Het
Frem1 A G 4: 82,972,165 S1007P probably damaging Het
Fry T C 5: 150,496,352 I993T possibly damaging Het
Fst A G 13: 114,454,502 S244P possibly damaging Het
Gcc1 T C 6: 28,421,010 T103A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gja3 T C 14: 57,036,762 D51G possibly damaging Het
Gm10305 A G 4: 99,273,076 D74G unknown Het
Gm12689 G T 4: 99,296,021 G37V unknown Het
Gm5424 C T 10: 62,071,534 noncoding transcript Het
Hephl1 T C 9: 15,084,524 E434G probably benign Het
Htatip2 T C 7: 49,773,311 C205R possibly damaging Het
Igf2r T C 17: 12,717,274 probably null Het
Ints2 T C 11: 86,233,196 I589V probably benign Het
Itgae T A 11: 73,114,907 V299D probably damaging Het
Kcnma1 T C 14: 23,509,784 probably benign Het
Kif11 A G 19: 37,413,117 probably benign Het
Kif13a A G 13: 46,778,888 probably benign Het
Kif18a T A 2: 109,298,322 probably benign Het
Klhl29 T C 12: 5,094,883 T406A probably benign Het
Litaf A T 16: 10,966,412 probably benign Het
Lmntd1 T A 6: 145,430,000 I71F probably benign Het
Lrit3 A C 3: 129,788,555 C594W probably damaging Het
Lrp6 T A 6: 134,479,775 Q842L possibly damaging Het
Lrrcc1 T A 3: 14,540,119 probably benign Het
Macf1 A T 4: 123,455,524 L1829* probably null Het
Mapk1ip1 T C 7: 138,835,955 T249A possibly damaging Het
Mfap4 T C 11: 61,487,180 F173L probably damaging Het
Mfsd9 C A 1: 40,790,474 probably benign Het
Mgat4b T C 11: 50,230,763 S69P probably damaging Het
Mki67 A T 7: 135,704,388 V620D probably damaging Het
Moxd1 C T 10: 24,252,954 T201I probably damaging Het
Msh4 G C 3: 153,866,420 D774E probably benign Het
Myg1 C T 15: 102,331,849 R37C probably benign Het
Myrf C A 19: 10,228,882 A57S probably benign Het
Ndst1 G A 18: 60,700,359 probably benign Het
Nedd4l A T 18: 65,208,503 probably benign Het
Neil2 T A 14: 63,183,400 I281F possibly damaging Het
Nfatc2 T A 2: 168,590,115 D26V probably benign Het
Nt5c A G 11: 115,490,714 probably null Het
Olfr1095 T C 2: 86,850,967 T244A probably benign Het
Olfr1369-ps1 G T 13: 21,115,908 C72F probably damaging Het
Olfr202 A G 16: 59,284,207 C97R possibly damaging Het
Olfr372 T A 8: 72,058,322 I214N probably damaging Het
Olfr538 T G 7: 140,574,507 M118R probably damaging Het
Ovch2 A G 7: 107,782,021 S557P probably benign Het
Pik3cg A G 12: 32,205,203 S262P probably benign Het
Pla2g6 T A 15: 79,306,396 H322L probably damaging Het
Plch1 A T 3: 63,699,219 L1079Q probably benign Het
Plekhg4 T A 8: 105,379,302 V777D probably damaging Het
Plekhg5 A G 4: 152,112,419 D747G possibly damaging Het
Poln C A 5: 34,118,958 V318F possibly damaging Het
Pou5f2 T A 13: 78,025,754 S272T probably benign Het
Ppp1r3e T G 14: 54,876,616 S200R possibly damaging Het
Prl7d1 G A 13: 27,710,182 P135S probably benign Het
Ptgs2 G A 1: 150,104,537 V409I probably benign Het
Ptk2b T C 14: 66,177,751 T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 T747A probably damaging Het
Qrfpr A G 3: 36,221,989 I84T probably damaging Het
Rab44 A G 17: 29,139,144 D102G possibly damaging Het
Rnf125 A T 18: 20,979,083 D57V possibly damaging Het
Rnf145 T C 11: 44,560,024 F392L probably damaging Het
Rttn A G 18: 88,989,546 N435S probably benign Het
Scn8a A G 15: 101,035,537 T1500A probably damaging Het
Sgsm1 A G 5: 113,285,123 probably benign Het
Sgsm3 A T 15: 81,011,736 *751C probably null Het
Slc35c2 A C 2: 165,280,929 L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 E396V probably damaging Het
Smarca4 G C 9: 21,658,984 probably benign Het
Snapc3 T A 4: 83,417,802 V17D probably damaging Het
Snta1 G T 2: 154,377,072 Q448K probably benign Het
Sptbn2 A G 19: 4,739,986 D1334G probably benign Het
Stard5 A G 7: 83,632,757 R41G probably damaging Het
Stxbp5 T A 10: 9,784,358 N731I probably benign Het
Tmem135 T A 7: 89,143,788 K413* probably null Het
Tmem38a G A 8: 72,580,018 V114I probably benign Het
Tpr A G 1: 150,422,531 T1057A probably damaging Het
Ttc23l A T 15: 10,539,980 L139Q probably damaging Het
Ttn T A 2: 76,755,296 probably null Het
Tuba3b A G 6: 145,619,576 T257A probably damaging Het
Tubgcp6 A C 15: 89,100,987 Y1633D probably damaging Het
Txnl1 C T 18: 63,671,573 probably benign Het
Unc13b A G 4: 43,182,849 Q3186R possibly damaging Het
Vmn2r75 T A 7: 86,163,270 S514C probably null Het
Zdhhc20 T C 14: 57,857,640 H154R probably damaging Het
Zfp462 A T 4: 55,007,563 M1L possibly damaging Het
Zfp831 A G 2: 174,645,290 K586R possibly damaging Het
Zfp990 A T 4: 145,537,302 H290L possibly damaging Het
Zfpm1 C T 8: 122,336,874 probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5207:Whrn UTSW 4 63432714 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5307:Whrn UTSW 4 63431843 missense probably benign 0.01
R5463:Whrn UTSW 4 63432816 missense probably benign 0.08
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6212:Whrn UTSW 4 63494686 nonsense probably null
R6380:Whrn UTSW 4 63418592 missense possibly damaging 0.90
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
R8334:Whrn UTSW 4 63494810 missense probably damaging 1.00
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Z1176:Whrn UTSW 4 63415566 missense probably damaging 1.00
Z1177:Whrn UTSW 4 63418499 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttacagatgagaaaacactgacac -3'
Posted On2013-07-11