Incidental Mutation 'R0631:Frem1'
ID57926
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission 038820-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R0631 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82972165 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1007 (S1007P)
Ref Sequence ENSEMBL: ENSMUSP00000102849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably benign
Transcript: ENSMUST00000071708
AA Change: S1026P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: S1026P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: S1007P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: S1007P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127886
SMART Domains Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049

DomainStartEndE-ValueType
Pfam:Cadherin_3 26 158 1.1e-18 PFAM
Pfam:Cadherin_3 150 300 4.6e-36 PFAM
Pfam:Cadherin_3 285 408 6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170248
AA Change: S1008P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: S1008P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Meta Mutation Damage Score 0.0980 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T A 9: 51,101,953 R6S probably benign Het
Aadat T C 8: 60,529,445 probably benign Het
Afap1l2 T C 19: 56,916,085 E594G probably benign Het
Ak8 T G 2: 28,735,665 I240S probably damaging Het
Akap13 T C 7: 75,614,996 V174A probably damaging Het
Alppl2 G A 1: 87,089,373 T66I probably damaging Het
Ankrd61 T A 5: 143,894,879 I36F probably damaging Het
Antxrl T A 14: 34,058,801 probably null Het
Arhgef2 G C 3: 88,634,436 V244L probably damaging Het
Arid1a A G 4: 133,689,170 I1098T unknown Het
Atr T C 9: 95,874,777 V903A possibly damaging Het
AW549877 A G 15: 3,986,489 probably benign Het
B3gnt6 C A 7: 98,193,692 A354S probably benign Het
Bnc1 A T 7: 81,974,366 I371N probably damaging Het
Camsap1 A T 2: 25,933,647 S1464T probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Cass4 T C 2: 172,432,411 I728T probably damaging Het
Ccdc88a A T 11: 29,493,752 M1378L probably damaging Het
Ccdc9 C A 7: 16,278,459 W266L probably damaging Het
Cct6b C A 11: 82,737,088 probably null Het
Cd177 T C 7: 24,756,686 E219G probably benign Het
Cdkal1 A T 13: 29,354,684 Y497* probably null Het
Chmp2a T C 7: 13,032,444 E107G probably damaging Het
Chrna2 T G 14: 66,149,308 V301G probably benign Het
Chrna7 A G 7: 63,099,643 C364R probably benign Het
Cltc G T 11: 86,712,613 L796I probably benign Het
Col12a1 T C 9: 79,703,376 T249A probably damaging Het
Col13a1 G A 10: 61,887,350 Q270* probably null Het
Col6a1 C T 10: 76,709,735 V968M probably benign Het
Copb1 C A 7: 114,233,282 V511F probably benign Het
Daw1 C G 1: 83,197,260 S160R probably damaging Het
Ddx46 A G 13: 55,639,777 probably benign Het
Depdc7 T C 2: 104,721,987 K492E possibly damaging Het
Dmbt1 C T 7: 131,097,653 A1004V possibly damaging Het
Dnah7b G A 1: 46,240,992 V2694I probably benign Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Edc4 C A 8: 105,890,792 A1052E possibly damaging Het
Eif2s2 T A 2: 154,884,358 K129M probably damaging Het
Emx2 A G 19: 59,464,028 D248G probably damaging Het
Erich6b T C 14: 75,659,009 probably benign Het
Exoc3l4 A G 12: 111,427,966 K507E probably benign Het
Fanci T A 7: 79,406,205 V195E probably damaging Het
Fgfr2 T G 7: 130,227,239 probably benign Het
Fry T C 5: 150,496,352 I993T possibly damaging Het
Fst A G 13: 114,454,502 S244P possibly damaging Het
Gcc1 T C 6: 28,421,010 T103A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gja3 T C 14: 57,036,762 D51G possibly damaging Het
Gm10305 A G 4: 99,273,076 D74G unknown Het
Gm12689 G T 4: 99,296,021 G37V unknown Het
Gm5424 C T 10: 62,071,534 noncoding transcript Het
Hephl1 T C 9: 15,084,524 E434G probably benign Het
Htatip2 T C 7: 49,773,311 C205R possibly damaging Het
Igf2r T C 17: 12,717,274 probably null Het
Ints2 T C 11: 86,233,196 I589V probably benign Het
Itgae T A 11: 73,114,907 V299D probably damaging Het
Kcnma1 T C 14: 23,509,784 probably benign Het
Kif11 A G 19: 37,413,117 probably benign Het
Kif13a A G 13: 46,778,888 probably benign Het
Kif18a T A 2: 109,298,322 probably benign Het
Klhl29 T C 12: 5,094,883 T406A probably benign Het
Litaf A T 16: 10,966,412 probably benign Het
Lmntd1 T A 6: 145,430,000 I71F probably benign Het
Lrit3 A C 3: 129,788,555 C594W probably damaging Het
Lrp6 T A 6: 134,479,775 Q842L possibly damaging Het
Lrrcc1 T A 3: 14,540,119 probably benign Het
Macf1 A T 4: 123,455,524 L1829* probably null Het
Mapk1ip1 T C 7: 138,835,955 T249A possibly damaging Het
Mfap4 T C 11: 61,487,180 F173L probably damaging Het
Mfsd9 C A 1: 40,790,474 probably benign Het
Mgat4b T C 11: 50,230,763 S69P probably damaging Het
Mki67 A T 7: 135,704,388 V620D probably damaging Het
Moxd1 C T 10: 24,252,954 T201I probably damaging Het
Msh4 G C 3: 153,866,420 D774E probably benign Het
Myg1 C T 15: 102,331,849 R37C probably benign Het
Myrf C A 19: 10,228,882 A57S probably benign Het
Ndst1 G A 18: 60,700,359 probably benign Het
Nedd4l A T 18: 65,208,503 probably benign Het
Neil2 T A 14: 63,183,400 I281F possibly damaging Het
Nfatc2 T A 2: 168,590,115 D26V probably benign Het
Nt5c A G 11: 115,490,714 probably null Het
Olfr1095 T C 2: 86,850,967 T244A probably benign Het
Olfr1369-ps1 G T 13: 21,115,908 C72F probably damaging Het
Olfr202 A G 16: 59,284,207 C97R possibly damaging Het
Olfr372 T A 8: 72,058,322 I214N probably damaging Het
Olfr538 T G 7: 140,574,507 M118R probably damaging Het
Ovch2 A G 7: 107,782,021 S557P probably benign Het
Pik3cg A G 12: 32,205,203 S262P probably benign Het
Pla2g6 T A 15: 79,306,396 H322L probably damaging Het
Plch1 A T 3: 63,699,219 L1079Q probably benign Het
Plekhg4 T A 8: 105,379,302 V777D probably damaging Het
Plekhg5 A G 4: 152,112,419 D747G possibly damaging Het
Poln C A 5: 34,118,958 V318F possibly damaging Het
Pou5f2 T A 13: 78,025,754 S272T probably benign Het
Ppp1r3e T G 14: 54,876,616 S200R possibly damaging Het
Prl7d1 G A 13: 27,710,182 P135S probably benign Het
Ptgs2 G A 1: 150,104,537 V409I probably benign Het
Ptk2b T C 14: 66,177,751 T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 T747A probably damaging Het
Qrfpr A G 3: 36,221,989 I84T probably damaging Het
Rab44 A G 17: 29,139,144 D102G possibly damaging Het
Rnf125 A T 18: 20,979,083 D57V possibly damaging Het
Rnf145 T C 11: 44,560,024 F392L probably damaging Het
Rttn A G 18: 88,989,546 N435S probably benign Het
Scn8a A G 15: 101,035,537 T1500A probably damaging Het
Sgsm1 A G 5: 113,285,123 probably benign Het
Sgsm3 A T 15: 81,011,736 *751C probably null Het
Slc35c2 A C 2: 165,280,929 L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 E396V probably damaging Het
Smarca4 G C 9: 21,658,984 probably benign Het
Snapc3 T A 4: 83,417,802 V17D probably damaging Het
Snta1 G T 2: 154,377,072 Q448K probably benign Het
Sptbn2 A G 19: 4,739,986 D1334G probably benign Het
Stard5 A G 7: 83,632,757 R41G probably damaging Het
Stxbp5 T A 10: 9,784,358 N731I probably benign Het
Tmem135 T A 7: 89,143,788 K413* probably null Het
Tmem38a G A 8: 72,580,018 V114I probably benign Het
Tpr A G 1: 150,422,531 T1057A probably damaging Het
Ttc23l A T 15: 10,539,980 L139Q probably damaging Het
Ttn T A 2: 76,755,296 probably null Het
Tuba3b A G 6: 145,619,576 T257A probably damaging Het
Tubgcp6 A C 15: 89,100,987 Y1633D probably damaging Het
Txnl1 C T 18: 63,671,573 probably benign Het
Unc13b A G 4: 43,182,849 Q3186R possibly damaging Het
Vmn2r75 T A 7: 86,163,270 S514C probably null Het
Whrn G A 4: 63,419,489 T545I probably damaging Het
Zdhhc20 T C 14: 57,857,640 H154R probably damaging Het
Zfp462 A T 4: 55,007,563 M1L possibly damaging Het
Zfp831 A G 2: 174,645,290 K586R possibly damaging Het
Zfp990 A T 4: 145,537,302 H290L possibly damaging Het
Zfpm1 C T 8: 122,336,874 probably benign Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCCCTCCAGCAGGCAAATG -3'
(R):5'- TTTCCAAAAGTCAGGACTCAGCACG -3'

Sequencing Primer
(F):5'- GTCCTTGTTGTAGAATGCACACAC -3'
(R):5'- TCAGGACTCAGCACGGTTATG -3'
Posted On2013-07-11