Incidental Mutation 'R7473:Lrguk'
ID 579263
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 045547-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7473 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34006630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 80 (K80M)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000101564] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: K80M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: K80M

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101564
AA Change: K80M

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099100
Gene: ENSMUSG00000056215
AA Change: K80M

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
Pfam:LRR_1 150 170 9e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: K80M

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 89,965,960 (GRCm39) probably null Het
A630095N17Rik G A 1: 75,208,675 (GRCm39) T15I unknown Het
Actr1b A G 1: 36,748,900 (GRCm39) V12A probably benign Het
Add1 A G 5: 34,776,697 (GRCm39) T473A possibly damaging Het
Akap11 A T 14: 78,751,328 (GRCm39) V353E Het
Alcam G A 16: 52,272,882 (GRCm39) probably benign Het
Alpi A G 1: 87,027,369 (GRCm39) probably null Het
Ap3s2 A G 7: 79,565,779 (GRCm39) F49S probably damaging Het
Arpc1a A G 5: 145,037,886 (GRCm39) K174E probably benign Het
Bbox1 A T 2: 110,095,843 (GRCm39) S374T probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bltp2 T C 11: 78,157,941 (GRCm39) S368P possibly damaging Het
Bmp2k A G 5: 97,204,871 (GRCm39) N402S probably benign Het
Bmper C A 9: 23,286,926 (GRCm39) A284D probably benign Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Bpifb2 A T 2: 153,723,116 (GRCm39) H124L possibly damaging Het
Bsn C T 9: 107,989,449 (GRCm39) R2101Q probably damaging Het
Cacng1 T A 11: 107,607,018 (GRCm39) D67V probably damaging Het
Catsperg1 A G 7: 28,894,903 (GRCm39) S565P probably damaging Het
Cep126 C T 9: 8,101,779 (GRCm39) E252K probably damaging Het
Cep55 G A 19: 38,058,384 (GRCm39) E326K probably damaging Het
Cfap58 T A 19: 47,963,064 (GRCm39) Y491* probably null Het
Cpeb2 T C 5: 43,434,848 (GRCm39) S747P Het
Cryz T A 3: 154,312,157 (GRCm39) S85T probably benign Het
D2hgdh T C 1: 93,765,800 (GRCm39) V367A probably damaging Het
Dgkh T C 14: 78,836,483 (GRCm39) N703S probably benign Het
Dnah11 T C 12: 117,866,911 (GRCm39) S4077G probably benign Het
Dnah14 A G 1: 181,579,704 (GRCm39) H3079R probably damaging Het
Dnah2 T A 11: 69,382,484 (GRCm39) T1209S probably damaging Het
Dnmt3b A G 2: 153,526,370 (GRCm39) D804G probably damaging Het
Ell2 A G 13: 75,898,154 (GRCm39) E143G probably damaging Het
Exoc2 A G 13: 31,006,613 (GRCm39) probably null Het
Fahd2a A T 2: 127,282,376 (GRCm39) I131N probably damaging Het
Fer1l5 A G 1: 36,460,689 (GRCm39) N1976D possibly damaging Het
Flt1 A G 5: 147,531,405 (GRCm39) S853P probably damaging Het
Frg2f1 C T 4: 119,387,990 (GRCm39) V170I probably benign Het
Gcn1 G A 5: 115,719,863 (GRCm39) V373M probably benign Het
Gm19965 A G 1: 116,749,602 (GRCm39) T428A unknown Het
Gm4792 A G 10: 94,129,730 (GRCm39) I124T unknown Het
Grik2 A T 10: 48,989,618 (GRCm39) C804S probably benign Het
Heatr6 T A 11: 83,672,217 (GRCm39) I1075N probably damaging Het
Hunk G A 16: 90,250,588 (GRCm39) A211T probably damaging Het
Ighe T C 12: 113,234,976 (GRCm39) I395V probably damaging Het
Ino80e A T 7: 126,456,484 (GRCm39) S104T probably damaging Het
Inpp4a A G 1: 37,408,534 (GRCm39) Y305C probably benign Het
Insrr T A 3: 87,711,838 (GRCm39) probably null Het
Itgae T G 11: 73,031,504 (GRCm39) D1073E possibly damaging Het
Klf11 G T 12: 24,705,141 (GRCm39) probably null Het
Map2 A T 1: 66,454,617 (GRCm39) D1169V probably damaging Het
Mpst G T 15: 78,297,726 (GRCm39) C248F probably damaging Het
Myo9a C A 9: 59,802,527 (GRCm39) Q2005K probably benign Het
Nfatc4 C T 14: 56,069,421 (GRCm39) T649I probably benign Het
Nmt1 A G 11: 102,937,226 (GRCm39) R88G probably benign Het
Nqo1 G A 8: 108,129,729 (GRCm39) probably benign Het
Nudt2 T G 4: 41,477,576 (GRCm39) M19R probably benign Het
Or10a49 T A 7: 108,467,476 (GRCm39) K295M probably damaging Het
Or12d2 T A 17: 37,624,522 (GRCm39) Y251F probably benign Het
Or9q2 C T 19: 13,772,526 (GRCm39) V150M probably benign Het
P2ry1 T A 3: 60,911,509 (GRCm39) I216N probably damaging Het
Pcx T A 19: 4,669,589 (GRCm39) L823* probably null Het
Pkhd1 A G 1: 20,619,980 (GRCm39) V880A probably damaging Het
Plcb1 A T 2: 135,186,196 (GRCm39) N721I probably damaging Het
Prdm15 T C 16: 97,623,046 (GRCm39) K269E possibly damaging Het
Prl7b1 A G 13: 27,785,996 (GRCm39) V224A possibly damaging Het
Reln A G 5: 22,134,125 (GRCm39) V2601A probably benign Het
Rspo4 G A 2: 151,714,993 (GRCm39) R210Q unknown Het
Slc7a5 A T 8: 122,615,162 (GRCm39) D228E probably benign Het
Spopfm2 T A 3: 94,083,509 (GRCm39) K101* probably null Het
Tas2r115 A G 6: 132,714,214 (GRCm39) S246P probably damaging Het
Tenm4 A G 7: 96,423,353 (GRCm39) Y716C probably damaging Het
Tgfb3 T C 12: 86,108,923 (GRCm39) K269E possibly damaging Het
Thoc6 A G 17: 23,889,841 (GRCm39) I27T probably benign Het
Tigd5 G A 15: 75,781,748 (GRCm39) G37S probably benign Het
Tmem259 C T 10: 79,815,506 (GRCm39) D102N possibly damaging Het
Tpo T G 12: 30,142,589 (GRCm39) I712L probably benign Het
Ttn G A 2: 76,700,892 (GRCm39) T21M possibly damaging Het
Utp20 A T 10: 88,656,572 (GRCm39) probably null Het
Xrcc5 A G 1: 72,351,748 (GRCm39) D106G probably damaging Het
Xrn1 T A 9: 95,861,194 (GRCm39) F451L probably benign Het
Zar1l T A 5: 150,441,203 (GRCm39) D141V probably damaging Het
Zfp27 A T 7: 29,595,324 (GRCm39) C214S possibly damaging Het
Znfx1 A T 2: 166,880,744 (GRCm39) C1211S probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGGAAAGGCACCCGTTTCAG -3'
(R):5'- AAAGAAAAGCCCTTGCCCTCTG -3'

Sequencing Primer
(F):5'- GGGTTTGGGCGCCTCTC -3'
(R):5'- CTAGAGTGGAGTGGGCTGAGC -3'
Posted On 2019-10-07