Incidental Mutation 'R7473:Ap3s2'
ID579267
Institutional Source Beutler Lab
Gene Symbol Ap3s2
Ensembl Gene ENSMUSG00000063801
Gene Nameadaptor-related protein complex 3, sigma 2 subunit
Synonymssigma 3B, [s]3B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7473 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79875325-79920649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79916031 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 49 (F49S)
Ref Sequence ENSEMBL: ENSMUSP00000075082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075657] [ENSMUST00000206725]
Predicted Effect probably damaging
Transcript: ENSMUST00000075657
AA Change: F49S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075082
Gene: ENSMUSG00000063801
AA Change: F49S

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 9.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206725
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,267,115 S368P possibly damaging Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933434E20Rik T C 3: 90,058,653 probably null Het
A630095N17Rik G A 1: 75,232,031 T15I unknown Het
Actr1b A G 1: 36,709,819 V12A probably benign Het
Add1 A G 5: 34,619,353 T473A possibly damaging Het
Akap11 A T 14: 78,513,888 V353E Het
Alcam G A 16: 52,452,519 probably benign Het
Alpi A G 1: 87,099,647 probably null Het
Arpc1a A G 5: 145,101,076 K174E probably benign Het
Bbox1 A T 2: 110,265,498 S374T probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bmp2k A G 5: 97,057,012 N402S probably benign Het
Bmper C A 9: 23,375,630 A284D probably benign Het
Bpifb2 A T 2: 153,881,196 H124L possibly damaging Het
Bsn C T 9: 108,112,250 R2101Q probably damaging Het
Cacng1 T A 11: 107,716,192 D67V probably damaging Het
Catsperg1 A G 7: 29,195,478 S565P probably damaging Het
Cep126 C T 9: 8,101,778 E252K probably damaging Het
Cep55 G A 19: 38,069,936 E326K probably damaging Het
Cfap58 T A 19: 47,974,625 Y491* probably null Het
Cpeb2 T C 5: 43,277,505 S747P Het
Cryz T A 3: 154,606,520 S85T probably benign Het
D2hgdh T C 1: 93,838,078 V367A probably damaging Het
Dgkh T C 14: 78,599,043 N703S probably benign Het
Dnah11 T C 12: 117,903,176 S4077G probably benign Het
Dnah14 A G 1: 181,752,139 H3079R probably damaging Het
Dnah2 T A 11: 69,491,658 T1209S probably damaging Het
Dnmt3b A G 2: 153,684,450 D804G probably damaging Het
Ell2 A G 13: 75,750,035 E143G probably damaging Het
Exoc2 A G 13: 30,822,630 probably null Het
Fahd2a A T 2: 127,440,456 I131N probably damaging Het
Fer1l5 A G 1: 36,421,608 N1976D possibly damaging Het
Flt1 A G 5: 147,594,595 S853P probably damaging Het
Frg2f1 C T 4: 119,530,793 V170I probably benign Het
Gcn1l1 G A 5: 115,581,804 V373M probably benign Het
Gm10696 T A 3: 94,176,202 K101* probably null Het
Gm19965 A G 1: 116,821,872 T428A unknown Het
Gm4792 A G 10: 94,293,868 I124T unknown Het
Grik2 A T 10: 49,113,522 C804S probably benign Het
Heatr6 T A 11: 83,781,391 I1075N probably damaging Het
Hunk G A 16: 90,453,700 A211T probably damaging Het
Ighe T C 12: 113,271,356 I395V probably damaging Het
Ino80e A T 7: 126,857,312 S104T probably damaging Het
Inpp4a A G 1: 37,369,453 Y305C probably benign Het
Insrr T A 3: 87,804,531 probably null Het
Itgae T G 11: 73,140,678 D1073E possibly damaging Het
Klf11 G T 12: 24,655,142 probably null Het
Lrguk A T 6: 34,029,695 K80M probably benign Het
Map2 A T 1: 66,415,458 D1169V probably damaging Het
Mpst G T 15: 78,413,526 C248F probably damaging Het
Myo9a C A 9: 59,895,244 Q2005K probably benign Het
Nfatc4 C T 14: 55,831,964 T649I probably benign Het
Nmt1 A G 11: 103,046,400 R88G probably benign Het
Nqo1 G A 8: 107,403,097 probably benign Het
Nudt2 T G 4: 41,477,576 M19R probably benign Het
Olfr102 T A 17: 37,313,631 Y251F probably benign Het
Olfr1497 C T 19: 13,795,162 V150M probably benign Het
Olfr517 T A 7: 108,868,269 K295M probably damaging Het
P2ry1 T A 3: 61,004,088 I216N probably damaging Het
Pcx T A 19: 4,619,561 L823* probably null Het
Pkhd1 A G 1: 20,549,756 V880A probably damaging Het
Plcb1 A T 2: 135,344,276 N721I probably damaging Het
Prdm15 T C 16: 97,821,846 K269E possibly damaging Het
Prl7b1 A G 13: 27,602,013 V224A possibly damaging Het
Reln A G 5: 21,929,127 V2601A probably benign Het
Rspo4 G A 2: 151,873,073 R210Q unknown Het
Slc7a5 A T 8: 121,888,423 D228E probably benign Het
Tas2r115 A G 6: 132,737,251 S246P probably damaging Het
Tenm4 A G 7: 96,774,146 Y716C probably damaging Het
Tgfb3 T C 12: 86,062,149 K269E possibly damaging Het
Thoc6 A G 17: 23,670,867 I27T probably benign Het
Tigd5 G A 15: 75,909,899 G37S probably benign Het
Tmem259 C T 10: 79,979,672 D102N possibly damaging Het
Tpo T G 12: 30,092,590 I712L probably benign Het
Ttn G A 2: 76,870,548 T21M possibly damaging Het
Utp20 A T 10: 88,820,710 probably null Het
Xrcc5 A G 1: 72,312,589 D106G probably damaging Het
Xrn1 T A 9: 95,979,141 F451L probably benign Het
Zar1l T A 5: 150,517,738 D141V probably damaging Het
Zfp27 A T 7: 29,895,899 C214S possibly damaging Het
Znfx1 A T 2: 167,038,824 C1211S probably damaging Het
Other mutations in Ap3s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ap3s2 APN 7 79916076 missense probably benign 0.35
R0138:Ap3s2 UTSW 7 79909869 missense probably benign 0.28
R0909:Ap3s2 UTSW 7 79880518 missense probably benign 0.01
R1711:Ap3s2 UTSW 7 79880490 missense probably damaging 0.98
R4909:Ap3s2 UTSW 7 79915241 missense possibly damaging 0.90
R5041:Ap3s2 UTSW 7 79920519 missense probably benign 0.07
R5528:Ap3s2 UTSW 7 79880486 makesense probably null
R5630:Ap3s2 UTSW 7 79909899 missense probably damaging 1.00
R6725:Ap3s2 UTSW 7 79920642 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCATGCTAAGAACAGGGTATATGG -3'
(R):5'- AGTTGTGCCCCATGTGGAAC -3'

Sequencing Primer
(F):5'- GAGAAACCTAGTTGTGTCCGACC -3'
(R):5'- CTGGAAGAGTACCCAGTGCTATTC -3'
Posted On2019-10-07