Incidental Mutation 'R7473:Bsn'
ID579278
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R7473 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108112250 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2101 (R2101Q)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: R2101Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: R2101Q

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,267,115 S368P possibly damaging Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933434E20Rik T C 3: 90,058,653 probably null Het
A630095N17Rik G A 1: 75,232,031 T15I unknown Het
Actr1b A G 1: 36,709,819 V12A probably benign Het
Add1 A G 5: 34,619,353 T473A possibly damaging Het
Akap11 A T 14: 78,513,888 V353E Het
Alcam G A 16: 52,452,519 probably benign Het
Alpi A G 1: 87,099,647 probably null Het
Ap3s2 A G 7: 79,916,031 F49S probably damaging Het
Arpc1a A G 5: 145,101,076 K174E probably benign Het
Bbox1 A T 2: 110,265,498 S374T probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bmp2k A G 5: 97,057,012 N402S probably benign Het
Bmper C A 9: 23,375,630 A284D probably benign Het
Bpifb2 A T 2: 153,881,196 H124L possibly damaging Het
Cacng1 T A 11: 107,716,192 D67V probably damaging Het
Catsperg1 A G 7: 29,195,478 S565P probably damaging Het
Cep126 C T 9: 8,101,778 E252K probably damaging Het
Cep55 G A 19: 38,069,936 E326K probably damaging Het
Cfap58 T A 19: 47,974,625 Y491* probably null Het
Cpeb2 T C 5: 43,277,505 S747P Het
Cryz T A 3: 154,606,520 S85T probably benign Het
D2hgdh T C 1: 93,838,078 V367A probably damaging Het
Dgkh T C 14: 78,599,043 N703S probably benign Het
Dnah11 T C 12: 117,903,176 S4077G probably benign Het
Dnah14 A G 1: 181,752,139 H3079R probably damaging Het
Dnah2 T A 11: 69,491,658 T1209S probably damaging Het
Dnmt3b A G 2: 153,684,450 D804G probably damaging Het
Ell2 A G 13: 75,750,035 E143G probably damaging Het
Exoc2 A G 13: 30,822,630 probably null Het
Fahd2a A T 2: 127,440,456 I131N probably damaging Het
Fer1l5 A G 1: 36,421,608 N1976D possibly damaging Het
Flt1 A G 5: 147,594,595 S853P probably damaging Het
Frg2f1 C T 4: 119,530,793 V170I probably benign Het
Gcn1l1 G A 5: 115,581,804 V373M probably benign Het
Gm10696 T A 3: 94,176,202 K101* probably null Het
Gm19965 A G 1: 116,821,872 T428A unknown Het
Gm4792 A G 10: 94,293,868 I124T unknown Het
Grik2 A T 10: 49,113,522 C804S probably benign Het
Heatr6 T A 11: 83,781,391 I1075N probably damaging Het
Hunk G A 16: 90,453,700 A211T probably damaging Het
Ighe T C 12: 113,271,356 I395V probably damaging Het
Ino80e A T 7: 126,857,312 S104T probably damaging Het
Inpp4a A G 1: 37,369,453 Y305C probably benign Het
Insrr T A 3: 87,804,531 probably null Het
Itgae T G 11: 73,140,678 D1073E possibly damaging Het
Klf11 G T 12: 24,655,142 probably null Het
Lrguk A T 6: 34,029,695 K80M probably benign Het
Map2 A T 1: 66,415,458 D1169V probably damaging Het
Mpst G T 15: 78,413,526 C248F probably damaging Het
Myo9a C A 9: 59,895,244 Q2005K probably benign Het
Nfatc4 C T 14: 55,831,964 T649I probably benign Het
Nmt1 A G 11: 103,046,400 R88G probably benign Het
Nqo1 G A 8: 107,403,097 probably benign Het
Nudt2 T G 4: 41,477,576 M19R probably benign Het
Olfr102 T A 17: 37,313,631 Y251F probably benign Het
Olfr1497 C T 19: 13,795,162 V150M probably benign Het
Olfr517 T A 7: 108,868,269 K295M probably damaging Het
P2ry1 T A 3: 61,004,088 I216N probably damaging Het
Pcx T A 19: 4,619,561 L823* probably null Het
Pkhd1 A G 1: 20,549,756 V880A probably damaging Het
Plcb1 A T 2: 135,344,276 N721I probably damaging Het
Prdm15 T C 16: 97,821,846 K269E possibly damaging Het
Prl7b1 A G 13: 27,602,013 V224A possibly damaging Het
Reln A G 5: 21,929,127 V2601A probably benign Het
Rspo4 G A 2: 151,873,073 R210Q unknown Het
Slc7a5 A T 8: 121,888,423 D228E probably benign Het
Tas2r115 A G 6: 132,737,251 S246P probably damaging Het
Tenm4 A G 7: 96,774,146 Y716C probably damaging Het
Tgfb3 T C 12: 86,062,149 K269E possibly damaging Het
Thoc6 A G 17: 23,670,867 I27T probably benign Het
Tigd5 G A 15: 75,909,899 G37S probably benign Het
Tmem259 C T 10: 79,979,672 D102N possibly damaging Het
Tpo T G 12: 30,092,590 I712L probably benign Het
Ttn G A 2: 76,870,548 T21M possibly damaging Het
Utp20 A T 10: 88,820,710 probably null Het
Xrcc5 A G 1: 72,312,589 D106G probably damaging Het
Xrn1 T A 9: 95,979,141 F451L probably benign Het
Zar1l T A 5: 150,517,738 D141V probably damaging Het
Zfp27 A T 7: 29,895,899 C214S possibly damaging Het
Znfx1 A T 2: 167,038,824 C1211S probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7951:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7980:Bsn UTSW 9 108111866 missense probably damaging 0.98
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGGTTTCCAGGGCTTG -3'
(R):5'- ACTTAGGGCAGGGCTTACAG -3'

Sequencing Primer
(F):5'- GCTTGGCTGCCCTTCTGG -3'
(R):5'- ACAGTATGGCTCCTTCACGGAC -3'
Posted On2019-10-07