Incidental Mutation 'R7473:Grik2'
ID579279
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Nameglutamate receptor, ionotropic, kainate 2 (beta 2)
SynonymsGlurbeta2, Glur-6, Glur6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7473 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location49094833-49788766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49113522 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 804 (C804S)
Ref Sequence ENSEMBL: ENSMUSP00000101124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218823]
Predicted Effect probably benign
Transcript: ENSMUST00000079751
AA Change: C804S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: C804S

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105484
AA Change: C804S

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: C804S

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218441
AA Change: C804S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218598
AA Change: C804S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000218823
AA Change: C804S

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,267,115 S368P possibly damaging Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933434E20Rik T C 3: 90,058,653 probably null Het
A630095N17Rik G A 1: 75,232,031 T15I unknown Het
Actr1b A G 1: 36,709,819 V12A probably benign Het
Add1 A G 5: 34,619,353 T473A possibly damaging Het
Akap11 A T 14: 78,513,888 V353E Het
Alcam G A 16: 52,452,519 probably benign Het
Alpi A G 1: 87,099,647 probably null Het
Ap3s2 A G 7: 79,916,031 F49S probably damaging Het
Arpc1a A G 5: 145,101,076 K174E probably benign Het
Bbox1 A T 2: 110,265,498 S374T probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bmp2k A G 5: 97,057,012 N402S probably benign Het
Bmper C A 9: 23,375,630 A284D probably benign Het
Bpifb2 A T 2: 153,881,196 H124L possibly damaging Het
Bsn C T 9: 108,112,250 R2101Q probably damaging Het
Cacng1 T A 11: 107,716,192 D67V probably damaging Het
Catsperg1 A G 7: 29,195,478 S565P probably damaging Het
Cep126 C T 9: 8,101,778 E252K probably damaging Het
Cep55 G A 19: 38,069,936 E326K probably damaging Het
Cfap58 T A 19: 47,974,625 Y491* probably null Het
Cpeb2 T C 5: 43,277,505 S747P Het
Cryz T A 3: 154,606,520 S85T probably benign Het
D2hgdh T C 1: 93,838,078 V367A probably damaging Het
Dgkh T C 14: 78,599,043 N703S probably benign Het
Dnah11 T C 12: 117,903,176 S4077G probably benign Het
Dnah14 A G 1: 181,752,139 H3079R probably damaging Het
Dnah2 T A 11: 69,491,658 T1209S probably damaging Het
Dnmt3b A G 2: 153,684,450 D804G probably damaging Het
Ell2 A G 13: 75,750,035 E143G probably damaging Het
Exoc2 A G 13: 30,822,630 probably null Het
Fahd2a A T 2: 127,440,456 I131N probably damaging Het
Fer1l5 A G 1: 36,421,608 N1976D possibly damaging Het
Flt1 A G 5: 147,594,595 S853P probably damaging Het
Frg2f1 C T 4: 119,530,793 V170I probably benign Het
Gcn1l1 G A 5: 115,581,804 V373M probably benign Het
Gm10696 T A 3: 94,176,202 K101* probably null Het
Gm19965 A G 1: 116,821,872 T428A unknown Het
Gm4792 A G 10: 94,293,868 I124T unknown Het
Heatr6 T A 11: 83,781,391 I1075N probably damaging Het
Hunk G A 16: 90,453,700 A211T probably damaging Het
Ighe T C 12: 113,271,356 I395V probably damaging Het
Ino80e A T 7: 126,857,312 S104T probably damaging Het
Inpp4a A G 1: 37,369,453 Y305C probably benign Het
Insrr T A 3: 87,804,531 probably null Het
Itgae T G 11: 73,140,678 D1073E possibly damaging Het
Klf11 G T 12: 24,655,142 probably null Het
Lrguk A T 6: 34,029,695 K80M probably benign Het
Map2 A T 1: 66,415,458 D1169V probably damaging Het
Mpst G T 15: 78,413,526 C248F probably damaging Het
Myo9a C A 9: 59,895,244 Q2005K probably benign Het
Nfatc4 C T 14: 55,831,964 T649I probably benign Het
Nmt1 A G 11: 103,046,400 R88G probably benign Het
Nqo1 G A 8: 107,403,097 probably benign Het
Nudt2 T G 4: 41,477,576 M19R probably benign Het
Olfr102 T A 17: 37,313,631 Y251F probably benign Het
Olfr1497 C T 19: 13,795,162 V150M probably benign Het
Olfr517 T A 7: 108,868,269 K295M probably damaging Het
P2ry1 T A 3: 61,004,088 I216N probably damaging Het
Pcx T A 19: 4,619,561 L823* probably null Het
Pkhd1 A G 1: 20,549,756 V880A probably damaging Het
Plcb1 A T 2: 135,344,276 N721I probably damaging Het
Prdm15 T C 16: 97,821,846 K269E possibly damaging Het
Prl7b1 A G 13: 27,602,013 V224A possibly damaging Het
Reln A G 5: 21,929,127 V2601A probably benign Het
Rspo4 G A 2: 151,873,073 R210Q unknown Het
Slc7a5 A T 8: 121,888,423 D228E probably benign Het
Tas2r115 A G 6: 132,737,251 S246P probably damaging Het
Tenm4 A G 7: 96,774,146 Y716C probably damaging Het
Tgfb3 T C 12: 86,062,149 K269E possibly damaging Het
Thoc6 A G 17: 23,670,867 I27T probably benign Het
Tigd5 G A 15: 75,909,899 G37S probably benign Het
Tmem259 C T 10: 79,979,672 D102N possibly damaging Het
Tpo T G 12: 30,092,590 I712L probably benign Het
Ttn G A 2: 76,870,548 T21M possibly damaging Het
Utp20 A T 10: 88,820,710 probably null Het
Xrcc5 A G 1: 72,312,589 D106G probably damaging Het
Xrn1 T A 9: 95,979,141 F451L probably benign Het
Zar1l T A 5: 150,517,738 D141V probably damaging Het
Zfp27 A T 7: 29,895,899 C214S possibly damaging Het
Znfx1 A T 2: 167,038,824 C1211S probably damaging Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49355928 missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49355938 missense probably damaging 1.00
IGL01012:Grik2 APN 10 49272956 missense probably damaging 1.00
IGL01302:Grik2 APN 10 49244330 missense probably damaging 0.99
IGL01657:Grik2 APN 10 49527986 critical splice donor site probably null
IGL02162:Grik2 APN 10 49422575 missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49422615 missense probably benign 0.16
IGL02512:Grik2 APN 10 49355912 missense probably benign 0.00
IGL02650:Grik2 APN 10 49101235 missense probably benign 0.03
IGL03283:Grik2 APN 10 49578269 missense probably benign 0.00
R0325:Grik2 UTSW 10 49240725 missense probably damaging 1.00
R0492:Grik2 UTSW 10 49101164 missense probably damaging 0.99
R0601:Grik2 UTSW 10 49422597 missense probably damaging 1.00
R0844:Grik2 UTSW 10 49101115 missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49527991 missense probably damaging 0.98
R1499:Grik2 UTSW 10 49132775 missense probably damaging 1.00
R1660:Grik2 UTSW 10 49244343 nonsense probably null
R1721:Grik2 UTSW 10 49523746 missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49355909 missense probably damaging 1.00
R1974:Grik2 UTSW 10 49132827 missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R3103:Grik2 UTSW 10 49240772 missense probably damaging 1.00
R3974:Grik2 UTSW 10 49422654 missense probably damaging 1.00
R4592:Grik2 UTSW 10 49422615 missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49523792 missense possibly damaging 0.71
R4748:Grik2 UTSW 10 49535341 missense possibly damaging 0.87
R4935:Grik2 UTSW 10 49240730 missense probably damaging 1.00
R4977:Grik2 UTSW 10 49132745 missense probably damaging 1.00
R5103:Grik2 UTSW 10 49496109 missense probably benign 0.33
R5330:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5331:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5736:Grik2 UTSW 10 49404410 missense probably damaging 0.96
R5740:Grik2 UTSW 10 49113477 missense probably damaging 0.99
R5747:Grik2 UTSW 10 49523774 missense probably benign
R6015:Grik2 UTSW 10 49523863 splice site probably null
R6311:Grik2 UTSW 10 49578138 missense probably damaging 0.98
R6474:Grik2 UTSW 10 49132680 missense probably benign
R6504:Grik2 UTSW 10 49356102 missense probably damaging 1.00
R6591:Grik2 UTSW 10 49272925 nonsense probably null
R6691:Grik2 UTSW 10 49272925 nonsense probably null
R6776:Grik2 UTSW 10 49355989 missense probably damaging 1.00
R7015:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R7094:Grik2 UTSW 10 49355916 missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49535367 missense probably benign 0.00
R7229:Grik2 UTSW 10 49101416 intron probably null
R7402:Grik2 UTSW 10 49535397 missense probably damaging 1.00
R7514:Grik2 UTSW 10 49523808 missense probably damaging 0.99
R7526:Grik2 UTSW 10 49523822 missense possibly damaging 0.56
R7657:Grik2 UTSW 10 49783151 missense probably benign 0.11
R7681:Grik2 UTSW 10 49244380 missense probably damaging 1.00
R7714:Grik2 UTSW 10 49419696 missense probably damaging 0.97
R8062:Grik2 UTSW 10 49240767 missense probably damaging 1.00
RF008:Grik2 UTSW 10 49244384 missense probably damaging 1.00
X0062:Grik2 UTSW 10 49272920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTCTCATGGTTGGAAATAGC -3'
(R):5'- ACACGATCCATTTCCTTTAGTGTG -3'

Sequencing Primer
(F):5'- TCATGGTTGGAAATAGCAGAAAATAG -3'
(R):5'- GGAGTCATTTTCTGTCATCCAAATAG -3'
Posted On2019-10-07