Incidental Mutation 'R7473:Itgae'
ID 579283
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms alpha-E1, CD103
MMRRC Submission 045547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7473 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72981409-73038272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 73031504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1073 (D1073E)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140]
AlphaFold Q60677
Predicted Effect possibly damaging
Transcript: ENSMUST00000006101
AA Change: D1073E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D1073E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik T C 3: 89,965,960 (GRCm39) probably null Het
A630095N17Rik G A 1: 75,208,675 (GRCm39) T15I unknown Het
Actr1b A G 1: 36,748,900 (GRCm39) V12A probably benign Het
Add1 A G 5: 34,776,697 (GRCm39) T473A possibly damaging Het
Akap11 A T 14: 78,751,328 (GRCm39) V353E Het
Alcam G A 16: 52,272,882 (GRCm39) probably benign Het
Alpi A G 1: 87,027,369 (GRCm39) probably null Het
Ap3s2 A G 7: 79,565,779 (GRCm39) F49S probably damaging Het
Arpc1a A G 5: 145,037,886 (GRCm39) K174E probably benign Het
Bbox1 A T 2: 110,095,843 (GRCm39) S374T probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Bltp2 T C 11: 78,157,941 (GRCm39) S368P possibly damaging Het
Bmp2k A G 5: 97,204,871 (GRCm39) N402S probably benign Het
Bmper C A 9: 23,286,926 (GRCm39) A284D probably benign Het
Bnip5 G A 17: 29,124,298 (GRCm39) R335W probably damaging Het
Bpifb2 A T 2: 153,723,116 (GRCm39) H124L possibly damaging Het
Bsn C T 9: 107,989,449 (GRCm39) R2101Q probably damaging Het
Cacng1 T A 11: 107,607,018 (GRCm39) D67V probably damaging Het
Catsperg1 A G 7: 28,894,903 (GRCm39) S565P probably damaging Het
Cep126 C T 9: 8,101,779 (GRCm39) E252K probably damaging Het
Cep55 G A 19: 38,058,384 (GRCm39) E326K probably damaging Het
Cfap58 T A 19: 47,963,064 (GRCm39) Y491* probably null Het
Cpeb2 T C 5: 43,434,848 (GRCm39) S747P Het
Cryz T A 3: 154,312,157 (GRCm39) S85T probably benign Het
D2hgdh T C 1: 93,765,800 (GRCm39) V367A probably damaging Het
Dgkh T C 14: 78,836,483 (GRCm39) N703S probably benign Het
Dnah11 T C 12: 117,866,911 (GRCm39) S4077G probably benign Het
Dnah14 A G 1: 181,579,704 (GRCm39) H3079R probably damaging Het
Dnah2 T A 11: 69,382,484 (GRCm39) T1209S probably damaging Het
Dnmt3b A G 2: 153,526,370 (GRCm39) D804G probably damaging Het
Ell2 A G 13: 75,898,154 (GRCm39) E143G probably damaging Het
Exoc2 A G 13: 31,006,613 (GRCm39) probably null Het
Fahd2a A T 2: 127,282,376 (GRCm39) I131N probably damaging Het
Fer1l5 A G 1: 36,460,689 (GRCm39) N1976D possibly damaging Het
Flt1 A G 5: 147,531,405 (GRCm39) S853P probably damaging Het
Frg2f1 C T 4: 119,387,990 (GRCm39) V170I probably benign Het
Gcn1 G A 5: 115,719,863 (GRCm39) V373M probably benign Het
Gm19965 A G 1: 116,749,602 (GRCm39) T428A unknown Het
Gm4792 A G 10: 94,129,730 (GRCm39) I124T unknown Het
Grik2 A T 10: 48,989,618 (GRCm39) C804S probably benign Het
Heatr6 T A 11: 83,672,217 (GRCm39) I1075N probably damaging Het
Hunk G A 16: 90,250,588 (GRCm39) A211T probably damaging Het
Ighe T C 12: 113,234,976 (GRCm39) I395V probably damaging Het
Ino80e A T 7: 126,456,484 (GRCm39) S104T probably damaging Het
Inpp4a A G 1: 37,408,534 (GRCm39) Y305C probably benign Het
Insrr T A 3: 87,711,838 (GRCm39) probably null Het
Klf11 G T 12: 24,705,141 (GRCm39) probably null Het
Lrguk A T 6: 34,006,630 (GRCm39) K80M probably benign Het
Map2 A T 1: 66,454,617 (GRCm39) D1169V probably damaging Het
Mpst G T 15: 78,297,726 (GRCm39) C248F probably damaging Het
Myo9a C A 9: 59,802,527 (GRCm39) Q2005K probably benign Het
Nfatc4 C T 14: 56,069,421 (GRCm39) T649I probably benign Het
Nmt1 A G 11: 102,937,226 (GRCm39) R88G probably benign Het
Nqo1 G A 8: 108,129,729 (GRCm39) probably benign Het
Nudt2 T G 4: 41,477,576 (GRCm39) M19R probably benign Het
Or10a49 T A 7: 108,467,476 (GRCm39) K295M probably damaging Het
Or12d2 T A 17: 37,624,522 (GRCm39) Y251F probably benign Het
Or9q2 C T 19: 13,772,526 (GRCm39) V150M probably benign Het
P2ry1 T A 3: 60,911,509 (GRCm39) I216N probably damaging Het
Pcx T A 19: 4,669,589 (GRCm39) L823* probably null Het
Pkhd1 A G 1: 20,619,980 (GRCm39) V880A probably damaging Het
Plcb1 A T 2: 135,186,196 (GRCm39) N721I probably damaging Het
Prdm15 T C 16: 97,623,046 (GRCm39) K269E possibly damaging Het
Prl7b1 A G 13: 27,785,996 (GRCm39) V224A possibly damaging Het
Reln A G 5: 22,134,125 (GRCm39) V2601A probably benign Het
Rspo4 G A 2: 151,714,993 (GRCm39) R210Q unknown Het
Slc7a5 A T 8: 122,615,162 (GRCm39) D228E probably benign Het
Spopfm2 T A 3: 94,083,509 (GRCm39) K101* probably null Het
Tas2r115 A G 6: 132,714,214 (GRCm39) S246P probably damaging Het
Tenm4 A G 7: 96,423,353 (GRCm39) Y716C probably damaging Het
Tgfb3 T C 12: 86,108,923 (GRCm39) K269E possibly damaging Het
Thoc6 A G 17: 23,889,841 (GRCm39) I27T probably benign Het
Tigd5 G A 15: 75,781,748 (GRCm39) G37S probably benign Het
Tmem259 C T 10: 79,815,506 (GRCm39) D102N possibly damaging Het
Tpo T G 12: 30,142,589 (GRCm39) I712L probably benign Het
Ttn G A 2: 76,700,892 (GRCm39) T21M possibly damaging Het
Utp20 A T 10: 88,656,572 (GRCm39) probably null Het
Xrcc5 A G 1: 72,351,748 (GRCm39) D106G probably damaging Het
Xrn1 T A 9: 95,861,194 (GRCm39) F451L probably benign Het
Zar1l T A 5: 150,441,203 (GRCm39) D141V probably damaging Het
Zfp27 A T 7: 29,595,324 (GRCm39) C214S possibly damaging Het
Znfx1 A T 2: 166,880,744 (GRCm39) C1211S probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,036,461 (GRCm39) missense probably benign 0.17
IGL00472:Itgae APN 11 73,004,520 (GRCm39) missense probably benign 0.06
IGL00821:Itgae APN 11 73,013,974 (GRCm39) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,010,263 (GRCm39) missense probably benign 0.00
IGL01639:Itgae APN 11 73,010,204 (GRCm39) missense probably benign 0.00
IGL01743:Itgae APN 11 73,002,585 (GRCm39) missense probably benign 0.02
IGL01911:Itgae APN 11 73,006,963 (GRCm39) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,009,010 (GRCm39) missense probably benign 0.29
IGL02149:Itgae APN 11 72,994,720 (GRCm39) missense probably benign 0.04
IGL02179:Itgae APN 11 73,024,844 (GRCm39) missense probably benign 0.06
IGL02231:Itgae APN 11 72,981,448 (GRCm39) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,009,361 (GRCm39) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,008,947 (GRCm39) missense probably benign 0.00
IGL02525:Itgae APN 11 73,021,777 (GRCm39) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,009,331 (GRCm39) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,009,029 (GRCm39) splice site probably benign
IGL02859:Itgae APN 11 73,005,693 (GRCm39) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,016,136 (GRCm39) missense probably benign 0.00
IGL03107:Itgae APN 11 73,004,427 (GRCm39) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,006,400 (GRCm39) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,024,680 (GRCm39) splice site probably null
IGL03352:Itgae APN 11 73,022,556 (GRCm39) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0225:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0320:Itgae UTSW 11 73,021,825 (GRCm39) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,008,973 (GRCm39) missense probably benign 0.13
R0403:Itgae UTSW 11 73,014,009 (GRCm39) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,005,733 (GRCm39) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0836:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0973:Itgae UTSW 11 73,029,335 (GRCm39) nonsense probably null
R1231:Itgae UTSW 11 73,010,205 (GRCm39) missense probably benign 0.02
R1389:Itgae UTSW 11 73,016,188 (GRCm39) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,006,418 (GRCm39) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,036,431 (GRCm39) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,007,988 (GRCm39) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R1915:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R2061:Itgae UTSW 11 73,009,448 (GRCm39) missense probably benign 0.00
R2380:Itgae UTSW 11 73,036,395 (GRCm39) missense probably benign 0.00
R2435:Itgae UTSW 11 73,012,763 (GRCm39) nonsense probably null
R2680:Itgae UTSW 11 73,005,752 (GRCm39) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,031,513 (GRCm39) missense probably benign 0.04
R3873:Itgae UTSW 11 73,004,442 (GRCm39) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,002,165 (GRCm39) missense probably benign 0.00
R4059:Itgae UTSW 11 73,002,960 (GRCm39) missense probably benign
R4212:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4213:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4691:Itgae UTSW 11 73,010,345 (GRCm39) nonsense probably null
R4736:Itgae UTSW 11 73,005,706 (GRCm39) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,021,821 (GRCm39) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,001,382 (GRCm39) missense probably benign 0.00
R5307:Itgae UTSW 11 73,036,464 (GRCm39) missense probably benign 0.00
R5362:Itgae UTSW 11 73,002,675 (GRCm39) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,024,734 (GRCm39) critical splice donor site probably null
R5645:Itgae UTSW 11 73,020,074 (GRCm39) missense probably damaging 1.00
R5672:Itgae UTSW 11 73,036,377 (GRCm39) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6226:Itgae UTSW 11 73,031,583 (GRCm39) missense probably benign 0.11
R6244:Itgae UTSW 11 73,036,427 (GRCm39) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,022,519 (GRCm39) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,002,228 (GRCm39) splice site probably null
R6502:Itgae UTSW 11 73,036,418 (GRCm39) missense probably benign 0.10
R6825:Itgae UTSW 11 73,009,322 (GRCm39) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,010,342 (GRCm39) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,002,195 (GRCm39) missense probably damaging 1.00
R7069:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R7132:Itgae UTSW 11 73,002,184 (GRCm39) missense possibly damaging 0.93
R7599:Itgae UTSW 11 73,012,786 (GRCm39) missense possibly damaging 0.62
R7637:Itgae UTSW 11 73,004,457 (GRCm39) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,014,095 (GRCm39) critical splice donor site probably null
R7829:Itgae UTSW 11 73,029,618 (GRCm39) missense probably benign
R7860:Itgae UTSW 11 73,011,099 (GRCm39) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,024,913 (GRCm39) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,011,210 (GRCm39) missense probably benign
R8911:Itgae UTSW 11 73,004,447 (GRCm39) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,016,089 (GRCm39) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,012,752 (GRCm39) missense probably benign 0.25
R9355:Itgae UTSW 11 73,006,906 (GRCm39) missense probably damaging 1.00
R9414:Itgae UTSW 11 73,002,629 (GRCm39) missense possibly damaging 0.59
R9595:Itgae UTSW 11 73,016,182 (GRCm39) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,011,171 (GRCm39) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,002,202 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1186:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1187:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1187:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1188:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1189:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1189:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1190:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1190:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1191:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1191:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1192:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1192:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1192:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1192:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGTCCGATGAGAGCAGTGTG -3'
(R):5'- CAGAAGCTCAGGGTCACAAG -3'

Sequencing Primer
(F):5'- AGCAGTGTGGTCTCCTGAC -3'
(R):5'- TCACAAGGGCGGTTGGTAG -3'
Posted On 2019-10-07