Mutagenetix > Incidental Mutation

Incidental Mutation 'R7473:Exoc2'

579293

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R7473 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 30822630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000021785

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102946

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

96% (80/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,267,115	S368P	possibly damaging	Het
4930539E08Rik	G	A	17: 28,905,324	R335W	probably damaging	Het
4933434E20Rik	T	C	3: 90,058,653		probably null	Het
A630095N17Rik	G	A	1: 75,232,031	T15I	unknown	Het
Actr1b	A	G	1: 36,709,819	V12A	probably benign	Het
Add1	A	G	5: 34,619,353	T473A	possibly damaging	Het
Akap11	A	T	14: 78,513,888	V353E		Het
Alcam	G	A	16: 52,452,519		probably benign	Het
Alpi	A	G	1: 87,099,647		probably null	Het
Ap3s2	A	G	7: 79,916,031	F49S	probably damaging	Het
Arpc1a	A	G	5: 145,101,076	K174E	probably benign	Het
Bbox1	A	T	2: 110,265,498	S374T	probably damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bmp2k	A	G	5: 97,057,012	N402S	probably benign	Het
Bmper	C	A	9: 23,375,630	A284D	probably benign	Het
Bpifb2	A	T	2: 153,881,196	H124L	possibly damaging	Het
Bsn	C	T	9: 108,112,250	R2101Q	probably damaging	Het
Cacng1	T	A	11: 107,716,192	D67V	probably damaging	Het
Catsperg1	A	G	7: 29,195,478	S565P	probably damaging	Het
Cep126	C	T	9: 8,101,778	E252K	probably damaging	Het
Cep55	G	A	19: 38,069,936	E326K	probably damaging	Het
Cfap58	T	A	19: 47,974,625	Y491*	probably null	Het
Cpeb2	T	C	5: 43,277,505	S747P		Het
Cryz	T	A	3: 154,606,520	S85T	probably benign	Het
D2hgdh	T	C	1: 93,838,078	V367A	probably damaging	Het
Dgkh	T	C	14: 78,599,043	N703S	probably benign	Het
Dnah11	T	C	12: 117,903,176	S4077G	probably benign	Het
Dnah14	A	G	1: 181,752,139	H3079R	probably damaging	Het
Dnah2	T	A	11: 69,491,658	T1209S	probably damaging	Het
Dnmt3b	A	G	2: 153,684,450	D804G	probably damaging	Het
Ell2	A	G	13: 75,750,035	E143G	probably damaging	Het
Fahd2a	A	T	2: 127,440,456	I131N	probably damaging	Het
Fer1l5	A	G	1: 36,421,608	N1976D	possibly damaging	Het
Flt1	A	G	5: 147,594,595	S853P	probably damaging	Het
Frg2f1	C	T	4: 119,530,793	V170I	probably benign	Het
Gcn1l1	G	A	5: 115,581,804	V373M	probably benign	Het
Gm10696	T	A	3: 94,176,202	K101*	probably null	Het
Gm19965	A	G	1: 116,821,872	T428A	unknown	Het
Gm4792	A	G	10: 94,293,868	I124T	unknown	Het
Grik2	A	T	10: 49,113,522	C804S	probably benign	Het
Heatr6	T	A	11: 83,781,391	I1075N	probably damaging	Het
Hunk	G	A	16: 90,453,700	A211T	probably damaging	Het
Ighe	T	C	12: 113,271,356	I395V	probably damaging	Het
Ino80e	A	T	7: 126,857,312	S104T	probably damaging	Het
Inpp4a	A	G	1: 37,369,453	Y305C	probably benign	Het
Insrr	T	A	3: 87,804,531		probably null	Het
Itgae	T	G	11: 73,140,678	D1073E	possibly damaging	Het
Klf11	G	T	12: 24,655,142		probably null	Het
Lrguk	A	T	6: 34,029,695	K80M	probably benign	Het
Map2	A	T	1: 66,415,458	D1169V	probably damaging	Het
Mpst	G	T	15: 78,413,526	C248F	probably damaging	Het
Myo9a	C	A	9: 59,895,244	Q2005K	probably benign	Het
Nfatc4	C	T	14: 55,831,964	T649I	probably benign	Het
Nmt1	A	G	11: 103,046,400	R88G	probably benign	Het
Nqo1	G	A	8: 107,403,097		probably benign	Het
Nudt2	T	G	4: 41,477,576	M19R	probably benign	Het
Olfr102	T	A	17: 37,313,631	Y251F	probably benign	Het
Olfr1497	C	T	19: 13,795,162	V150M	probably benign	Het
Olfr517	T	A	7: 108,868,269	K295M	probably damaging	Het
P2ry1	T	A	3: 61,004,088	I216N	probably damaging	Het
Pcx	T	A	19: 4,619,561	L823*	probably null	Het
Pkhd1	A	G	1: 20,549,756	V880A	probably damaging	Het
Plcb1	A	T	2: 135,344,276	N721I	probably damaging	Het
Prdm15	T	C	16: 97,821,846	K269E	possibly damaging	Het
Prl7b1	A	G	13: 27,602,013	V224A	possibly damaging	Het
Reln	A	G	5: 21,929,127	V2601A	probably benign	Het
Rspo4	G	A	2: 151,873,073	R210Q	unknown	Het
Slc7a5	A	T	8: 121,888,423	D228E	probably benign	Het
Tas2r115	A	G	6: 132,737,251	S246P	probably damaging	Het
Tenm4	A	G	7: 96,774,146	Y716C	probably damaging	Het
Tgfb3	T	C	12: 86,062,149	K269E	possibly damaging	Het
Thoc6	A	G	17: 23,670,867	I27T	probably benign	Het
Tigd5	G	A	15: 75,909,899	G37S	probably benign	Het
Tmem259	C	T	10: 79,979,672	D102N	possibly damaging	Het
Tpo	T	G	12: 30,092,590	I712L	probably benign	Het
Ttn	G	A	2: 76,870,548	T21M	possibly damaging	Het
Utp20	A	T	10: 88,820,710		probably null	Het
Xrcc5	A	G	1: 72,312,589	D106G	probably damaging	Het
Xrn1	T	A	9: 95,979,141	F451L	probably benign	Het
Zar1l	T	A	5: 150,517,738	D141V	probably damaging	Het
Zfp27	A	T	7: 29,895,899	C214S	possibly damaging	Het
Znfx1	A	T	2: 167,038,824	C1211S	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCAACACATCATCAGGAAAGTG -3'
(R):5'- CTGCAATGCCTTTTAGAAACGAAG -3'

Sequencing Primer
(F):5'- CATCATCAGGAAAGTGAGATCAC -3'
(R):5'- TGCAGAAGACATAGATTTGGTCCCC -3'

Posted On

2019-10-07