Incidental Mutation 'R7474:Rnf2'
ID579317
Institutional Source Beutler Lab
Gene Symbol Rnf2
Ensembl Gene ENSMUSG00000026484
Gene Namering finger protein 2
SynonymsdinG, Ring1B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location151458004-151500955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 151471716 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 277 (E277D)
Ref Sequence ENSEMBL: ENSMUSP00000075476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076110] [ENSMUST00000186415] [ENSMUST00000187048] [ENSMUST00000190070]
PDB Structure
RING1B-BMI1 E3 CATALYTIC DOMAIN STRUCTURE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000076110
AA Change: E277D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075476
Gene: ENSMUSG00000026484
AA Change: E277D

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
Pfam:RAWUL 234 330 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186415
AA Change: E205D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140594
Gene: ENSMUSG00000026484
AA Change: E205D

DomainStartEndE-ValueType
RING 51 110 3.24e-4 SMART
PDB:3H8H|A 148 258 4e-78 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000187048
AA Change: E277D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140896
Gene: ENSMUSG00000026484
AA Change: E277D

DomainStartEndE-ValueType
RING 51 90 1.7e-7 SMART
PDB:3H8H|A 220 330 4e-77 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190070
AA Change: E130D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484
AA Change: E130D

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polycomb group (PcG) of proteins form the multiprotein complexes that are important for the transcription repression of various genes involved in development and cell proliferation. The protein encoded by this gene is one of the PcG proteins. It has been shown to interact with, and suppress the activity of, transcription factor CP2 (TFCP2/CP2). Studies of the mouse counterpart suggested the involvement of this gene in the specification of anterior-posterior axis, as well as in cell proliferation in early development. This protein was also found to interact with huntingtin interacting protein 2 (HIP2), an ubiquitin-conjugating enzyme, and possess ubiquitin ligase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a null allele show an early growth arrest, failure to progress through gastrulation, impaired epiblast expansion, accumulation of posterior mesoderm and die before E10.5. Mice homozygous for a hypomorphic allele show posterior homeotic transformations of the axial skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Rnf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:Rnf2 APN 1 151471695 missense probably benign 0.03
R1913:Rnf2 UTSW 1 151476185 missense probably damaging 1.00
R4333:Rnf2 UTSW 1 151473076 missense possibly damaging 0.68
R4965:Rnf2 UTSW 1 151473217 nonsense probably null
R6323:Rnf2 UTSW 1 151473216 missense probably damaging 0.98
R6886:Rnf2 UTSW 1 151473266 missense possibly damaging 0.85
R7386:Rnf2 UTSW 1 151471380 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGCGGCTTTGCTTCG -3'
(R):5'- ACCTGCCTTTGCTTATTATAGAGCAG -3'

Sequencing Primer
(F):5'- TGCTTCGTGGGCCTCAG -3'
(R):5'- GGCTCCATGATTTAGGAACTT -3'
Posted On2019-10-07