Mutagenetix > Incidental Mutation

Incidental Mutation 'R7474:Lamc1'

579318

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7474 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 153332265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 92 (A92V)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027752
AA Change: A92V

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: A92V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,328,088	C3089*	probably null	Het
Abcc1	A	G	16: 14,472,986	T1487A	possibly damaging	Het
Agfg1	T	A	1: 82,882,411	L333*	probably null	Het
Agfg2	C	A	5: 137,653,868	V410F	possibly damaging	Het
Amotl2	T	C	9: 102,730,111	V706A	probably benign	Het
Apob	A	T	12: 8,009,185	T2556S	probably benign	Het
Asb18	T	A	1: 89,993,033	H174L	possibly damaging	Het
Atp10a	G	A	7: 58,658,527	E25K	unknown	Het
Aup1	T	C	6: 83,054,967	L65P	probably benign	Het
Blvra	T	C	2: 127,086,849	F86L	probably damaging	Het
Cabp4	T	C	19: 4,139,399	D53G	probably benign	Het
Cd300c2	T	A	11: 114,998,296	E153V	probably benign	Het
Crxos	A	G	7: 15,902,931	E143G	possibly damaging	Het
Csmd2	A	G	4: 128,546,127	N3125D		Het
Cyp2c67	T	A	19: 39,617,432	Q340L	probably null	Het
Dscam	T	A	16: 96,819,889	N540Y	possibly damaging	Het
E2f8	G	A	7: 48,875,760	R155W	probably damaging	Het
Ext1	A	T	15: 53,344,489	V292D	probably damaging	Het
Extl3	T	C	14: 65,076,641	E364G	possibly damaging	Het
Fmn2	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	1: 174,609,203		probably benign	Het
Fsd1	A	T	17: 55,988,149	D46V	possibly damaging	Het
Gcnt2	T	A	13: 40,958,257	L374H	probably damaging	Het
Gm10309	G	A	17: 86,504,667		probably benign	Het
Gm13084	T	C	4: 143,811,699	D234G	probably benign	Het
Gm14410	A	T	2: 177,202,825		probably null	Het
Gm5114	A	T	7: 39,407,980	S738R	probably benign	Het
Gtf3c2	C	A	5: 31,167,756	G502W	probably damaging	Het
Insc	G	A	7: 114,768,823		probably null	Het
Kcnt2	T	C	1: 140,570,478	Y898H	possibly damaging	Het
Kctd19	C	A	8: 105,392,032	R299L	probably benign	Het
Klf10	T	C	15: 38,297,202	N198S	probably benign	Het
L3mbtl1	A	T	2: 162,966,604	D574V	probably damaging	Het
Lrrc63	T	A	14: 75,126,203	T163S	possibly damaging	Het
Mak	T	A	13: 41,051,480	K127N	probably damaging	Het
Mdga2	G	A	12: 66,486,761	Q945*	probably null	Het
Mthfr	T	A	4: 148,052,602	I519N	possibly damaging	Het
Mtmr2	C	A	9: 13,799,225	H357N	probably damaging	Het
Myh13	A	T	11: 67,327,164	E21V	possibly damaging	Het
Myh13	A	C	11: 67,367,711	Q184P		Het
Nans	T	A	4: 46,502,484	L307Q	probably damaging	Het
Ncan	C	A	8: 70,102,041	R1042L	possibly damaging	Het
Nrg3	T	C	14: 39,011,999	E310G	probably damaging	Het
Obsl1	A	C	1: 75,498,184	N857K	probably benign	Het
Olfml2a	T	C	2: 38,960,261	V663A	probably damaging	Het
Olfr1104	T	C	2: 87,022,554		probably benign	Het
Olfr116	T	C	17: 37,624,386	D83G	probably benign	Het
Olfr213	G	T	6: 116,541,038	C195F	probably damaging	Het
Olfr603	A	G	7: 103,383,762	I80T	probably damaging	Het
Olfr621-ps1	C	A	7: 103,629,147	W271L	unknown	Het
Pla2g4a	T	C	1: 149,865,200	M363V	possibly damaging	Het
Prickle1	A	T	15: 93,508,671	V157D	possibly damaging	Het
Pstk	A	G	7: 131,373,633	N105S	probably benign	Het
Ptpn21	A	G	12: 98,737,363		probably null	Het
Rnf2	T	A	1: 151,471,716	E277D	probably benign	Het
Rnpepl1	T	C	1: 92,918,972	F532S	probably benign	Het
Rtn1	C	T	12: 72,308,390	A261T	possibly damaging	Het
Ryr2	A	G	13: 11,594,876	S4355P	probably benign	Het
Sacs	T	G	14: 61,211,178	L3558V	probably benign	Het
Senp6	T	C	9: 80,142,328	V1047A	probably damaging	Het
Slco2b1	A	T	7: 99,664,832	C515S	probably damaging	Het
Smgc	T	A	15: 91,860,694	V732E	possibly damaging	Het
Sorcs1	T	C	19: 50,153,112	M1105V	possibly damaging	Het
Spats1	A	G	17: 45,457,161	Y160H	possibly damaging	Het
Tnfsf14	T	A	17: 57,190,848	D128V		Het
Tns3	T	C	11: 8,530,894	Q234R	probably damaging	Het
Uxs1	A	G	1: 43,757,024	V306A	possibly damaging	Het
Vac14	T	A	8: 110,636,434	V304D	probably damaging	Het
Vangl1	A	G	3: 102,184,249	F174L	probably benign	Het
Vav1	A	G	17: 57,299,102	E242G	probably benign	Het
Vsir	A	G	10: 60,368,922	N305D	probably benign	Het
Vwce	T	A	19: 10,646,941	C399S	possibly damaging	Het
Wrn	A	T	8: 33,329,181	L248M	probably damaging	Het
Zfp141	T	A	7: 42,476,254	K265*	probably null	Het
Zfp735	A	T	11: 73,711,176	K315N	possibly damaging	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8315:Lamc1	UTSW	1	153243421	missense	probably benign	0.00
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGACCGTGAGCGAGTAGTG -3'
(R):5'- GGTTTTCTCCACCGCCAGAT -3'

Sequencing Primer
(F):5'- CGTGAGCGAGTAGTGGGGAC -3'
(R):5'- AGGATCGGCCTCGGGATAC -3'

Posted On

2019-10-07