Incidental Mutation 'R7474:Lamc1'
ID 579318
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission 045548-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 153094668-153208532 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 153208011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 92 (A92V)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027752
AA Change: A92V

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: A92V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,278,088 (GRCm39) C3089* probably null Het
Abcc1 A G 16: 14,290,850 (GRCm39) T1487A possibly damaging Het
Agfg1 T A 1: 82,860,132 (GRCm39) L333* probably null Het
Agfg2 C A 5: 137,652,130 (GRCm39) V410F possibly damaging Het
Amotl2 T C 9: 102,607,310 (GRCm39) V706A probably benign Het
Apob A T 12: 8,059,185 (GRCm39) T2556S probably benign Het
Asb18 T A 1: 89,920,755 (GRCm39) H174L possibly damaging Het
Atp10a G A 7: 58,308,275 (GRCm39) E25K unknown Het
Aup1 T C 6: 83,031,948 (GRCm39) L65P probably benign Het
Blvra T C 2: 126,928,769 (GRCm39) F86L probably damaging Het
Cabp4 T C 19: 4,189,398 (GRCm39) D53G probably benign Het
Cd300c2 T A 11: 114,889,122 (GRCm39) E153V probably benign Het
Crxos A G 7: 15,636,856 (GRCm39) E143G possibly damaging Het
Csmd2 A G 4: 128,439,920 (GRCm39) N3125D Het
Cyp2c67 T A 19: 39,605,876 (GRCm39) Q340L probably null Het
Dscam T A 16: 96,621,089 (GRCm39) N540Y possibly damaging Het
E2f8 G A 7: 48,525,508 (GRCm39) R155W probably damaging Het
Ext1 A T 15: 53,207,885 (GRCm39) V292D probably damaging Het
Extl3 T C 14: 65,314,090 (GRCm39) E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fsd1 A T 17: 56,295,149 (GRCm39) D46V possibly damaging Het
Gcnt2 T A 13: 41,111,733 (GRCm39) L374H probably damaging Het
Gm10309 G A 17: 86,812,095 (GRCm39) probably benign Het
Gm14410 A T 2: 176,894,618 (GRCm39) probably null Het
Gm5114 A T 7: 39,057,404 (GRCm39) S738R probably benign Het
Gtf3c2 C A 5: 31,325,100 (GRCm39) G502W probably damaging Het
Insc G A 7: 114,368,058 (GRCm39) probably null Het
Kcnt2 T C 1: 140,498,216 (GRCm39) Y898H possibly damaging Het
Kctd19 C A 8: 106,118,664 (GRCm39) R299L probably benign Het
Klf10 T C 15: 38,297,446 (GRCm39) N198S probably benign Het
L3mbtl1 A T 2: 162,808,524 (GRCm39) D574V probably damaging Het
Lrrc63 T A 14: 75,363,643 (GRCm39) T163S possibly damaging Het
Mak T A 13: 41,204,956 (GRCm39) K127N probably damaging Het
Mdga2 G A 12: 66,533,535 (GRCm39) Q945* probably null Het
Mthfr T A 4: 148,137,059 (GRCm39) I519N possibly damaging Het
Mtmr2 C A 9: 13,710,521 (GRCm39) H357N probably damaging Het
Myh13 A T 11: 67,217,990 (GRCm39) E21V possibly damaging Het
Myh13 A C 11: 67,258,537 (GRCm39) Q184P Het
Nans T A 4: 46,502,484 (GRCm39) L307Q probably damaging Het
Ncan C A 8: 70,554,691 (GRCm39) R1042L possibly damaging Het
Nrg3 T C 14: 38,733,956 (GRCm39) E310G probably damaging Het
Obsl1 A C 1: 75,474,828 (GRCm39) N857K probably benign Het
Olfml2a T C 2: 38,850,273 (GRCm39) V663A probably damaging Het
Or14j10 T C 17: 37,935,277 (GRCm39) D83G probably benign Het
Or51v15-ps1 C A 7: 103,278,354 (GRCm39) W271L unknown Het
Or52e19b A G 7: 103,032,969 (GRCm39) I80T probably damaging Het
Or6d13 G T 6: 116,517,999 (GRCm39) C195F probably damaging Het
Or8i2 T C 2: 86,852,898 (GRCm39) probably benign Het
Pla2g4a T C 1: 149,740,951 (GRCm39) M363V possibly damaging Het
Pramel26 T C 4: 143,538,269 (GRCm39) D234G probably benign Het
Prickle1 A T 15: 93,406,552 (GRCm39) V157D possibly damaging Het
Pstk A G 7: 130,975,362 (GRCm39) N105S probably benign Het
Ptpn21 A G 12: 98,703,622 (GRCm39) probably null Het
Rnf2 T A 1: 151,347,467 (GRCm39) E277D probably benign Het
Rnpepl1 T C 1: 92,846,694 (GRCm39) F532S probably benign Het
Rtn1 C T 12: 72,355,164 (GRCm39) A261T possibly damaging Het
Ryr2 A G 13: 11,609,762 (GRCm39) S4355P probably benign Het
Sacs T G 14: 61,448,627 (GRCm39) L3558V probably benign Het
Senp6 T C 9: 80,049,610 (GRCm39) V1047A probably damaging Het
Slco2b1 A T 7: 99,314,039 (GRCm39) C515S probably damaging Het
Smgc T A 15: 91,744,892 (GRCm39) V732E possibly damaging Het
Sorcs1 T C 19: 50,141,550 (GRCm39) M1105V possibly damaging Het
Spats1 A G 17: 45,768,087 (GRCm39) Y160H possibly damaging Het
Tnfsf14 T A 17: 57,497,848 (GRCm39) D128V Het
Tns3 T C 11: 8,480,894 (GRCm39) Q234R probably damaging Het
Uxs1 A G 1: 43,796,184 (GRCm39) V306A possibly damaging Het
Vac14 T A 8: 111,363,066 (GRCm39) V304D probably damaging Het
Vangl1 A G 3: 102,091,565 (GRCm39) F174L probably benign Het
Vav1 A G 17: 57,606,102 (GRCm39) E242G probably benign Het
Vsir A G 10: 60,204,701 (GRCm39) N305D probably benign Het
Vwce T A 19: 10,624,305 (GRCm39) C399S possibly damaging Het
Wrn A T 8: 33,819,209 (GRCm39) L248M probably damaging Het
Zfp141 T A 7: 42,125,678 (GRCm39) K265* probably null Het
Zfp735 A T 11: 73,602,002 (GRCm39) K315N possibly damaging Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153,116,241 (GRCm39) missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153,126,880 (GRCm39) missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153,097,319 (GRCm39) missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153,122,828 (GRCm39) missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153,116,179 (GRCm39) missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153,122,788 (GRCm39) missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153,125,599 (GRCm39) missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153,126,407 (GRCm39) missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153,122,801 (GRCm39) missense probably benign 0.00
IGL03069:Lamc1 APN 1 153,115,127 (GRCm39) missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153,208,020 (GRCm39) missense probably benign 0.00
IGL03166:Lamc1 APN 1 153,208,047 (GRCm39) missense probably benign 0.01
IGL03285:Lamc1 APN 1 153,103,431 (GRCm39) missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153,138,392 (GRCm39) missense probably damaging 1.00
pride UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
Stratum UTSW 1 153,126,870 (GRCm39) nonsense probably null
tier UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153,119,217 (GRCm39) missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153,138,329 (GRCm39) missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153,117,614 (GRCm39) unclassified probably benign
R0078:Lamc1 UTSW 1 153,104,936 (GRCm39) missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153,138,353 (GRCm39) missense probably benign 0.00
R0282:Lamc1 UTSW 1 153,131,058 (GRCm39) missense probably benign
R0374:Lamc1 UTSW 1 153,126,811 (GRCm39) splice site probably benign
R0494:Lamc1 UTSW 1 153,122,682 (GRCm39) critical splice donor site probably null
R0502:Lamc1 UTSW 1 153,122,678 (GRCm39) splice site probably benign
R0755:Lamc1 UTSW 1 153,123,196 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0792:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0892:Lamc1 UTSW 1 153,208,000 (GRCm39) missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153,208,020 (GRCm39) missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153,097,446 (GRCm39) missense probably benign 0.03
R0961:Lamc1 UTSW 1 153,097,392 (GRCm39) frame shift probably null
R0963:Lamc1 UTSW 1 153,119,132 (GRCm39) missense probably benign
R1127:Lamc1 UTSW 1 153,126,205 (GRCm39) missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1175:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1449:Lamc1 UTSW 1 153,126,241 (GRCm39) missense probably benign
R1481:Lamc1 UTSW 1 153,097,380 (GRCm39) missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153,118,489 (GRCm39) missense probably benign 0.34
R1583:Lamc1 UTSW 1 153,119,224 (GRCm39) critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153,133,818 (GRCm39) splice site probably benign
R1652:Lamc1 UTSW 1 153,125,392 (GRCm39) missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153,122,995 (GRCm39) missense probably benign 0.04
R1854:Lamc1 UTSW 1 153,125,618 (GRCm39) missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153,118,378 (GRCm39) missense probably benign 0.07
R2170:Lamc1 UTSW 1 153,124,888 (GRCm39) missense probably benign 0.07
R2410:Lamc1 UTSW 1 153,123,141 (GRCm39) missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153,102,161 (GRCm39) missense probably benign 0.04
R3615:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153,130,951 (GRCm39) missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153,138,454 (GRCm39) splice site probably null
R4285:Lamc1 UTSW 1 153,110,298 (GRCm39) missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153,097,274 (GRCm39) missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153,123,015 (GRCm39) missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153,118,442 (GRCm39) missense probably benign 0.04
R4649:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153,104,846 (GRCm39) missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153,109,310 (GRCm39) missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153,127,716 (GRCm39) missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
R6233:Lamc1 UTSW 1 153,099,412 (GRCm39) missense probably benign
R6431:Lamc1 UTSW 1 153,097,417 (GRCm39) missense probably benign 0.21
R6636:Lamc1 UTSW 1 153,117,721 (GRCm39) missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153,138,238 (GRCm39) missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153,102,200 (GRCm39) missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153,110,396 (GRCm39) missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153,124,822 (GRCm39) missense probably damaging 1.00
R7570:Lamc1 UTSW 1 153,119,021 (GRCm39) missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153,118,978 (GRCm39) missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153,116,200 (GRCm39) missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153,124,806 (GRCm39) missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153,123,014 (GRCm39) missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153,097,358 (GRCm39) missense probably benign 0.04
R8207:Lamc1 UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153,123,073 (GRCm39) missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153,099,500 (GRCm39) missense probably benign 0.04
R8315:Lamc1 UTSW 1 153,119,167 (GRCm39) missense probably benign 0.00
R8417:Lamc1 UTSW 1 153,106,515 (GRCm39) missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153,109,288 (GRCm39) missense probably benign 0.31
R8827:Lamc1 UTSW 1 153,097,424 (GRCm39) missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153,207,993 (GRCm39) missense probably benign 0.00
R9061:Lamc1 UTSW 1 153,126,870 (GRCm39) nonsense probably null
R9141:Lamc1 UTSW 1 153,123,196 (GRCm39) missense probably benign 0.01
R9187:Lamc1 UTSW 1 153,097,434 (GRCm39) nonsense probably null
R9206:Lamc1 UTSW 1 153,126,197 (GRCm39) missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153,119,087 (GRCm39) missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153,115,009 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGACCGTGAGCGAGTAGTG -3'
(R):5'- GGTTTTCTCCACCGCCAGAT -3'

Sequencing Primer
(F):5'- CGTGAGCGAGTAGTGGGGAC -3'
(R):5'- AGGATCGGCCTCGGGATAC -3'
Posted On 2019-10-07