Incidental Mutation 'R7474:Fmn2'
ID 579319
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Name formin 2
Synonyms
MMRRC Submission 045548-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.816) question?
Stock # R7474 (G1)
Quality Score 159.457
Status Not validated
Chromosome 1
Chromosomal Location 174329391-174650295 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC at 174436769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
AlphaFold Q9JL04
Predicted Effect probably benign
Transcript: ENSMUST00000030039
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000195621
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,278,088 (GRCm39) C3089* probably null Het
Abcc1 A G 16: 14,290,850 (GRCm39) T1487A possibly damaging Het
Agfg1 T A 1: 82,860,132 (GRCm39) L333* probably null Het
Agfg2 C A 5: 137,652,130 (GRCm39) V410F possibly damaging Het
Amotl2 T C 9: 102,607,310 (GRCm39) V706A probably benign Het
Apob A T 12: 8,059,185 (GRCm39) T2556S probably benign Het
Asb18 T A 1: 89,920,755 (GRCm39) H174L possibly damaging Het
Atp10a G A 7: 58,308,275 (GRCm39) E25K unknown Het
Aup1 T C 6: 83,031,948 (GRCm39) L65P probably benign Het
Blvra T C 2: 126,928,769 (GRCm39) F86L probably damaging Het
Cabp4 T C 19: 4,189,398 (GRCm39) D53G probably benign Het
Cd300c2 T A 11: 114,889,122 (GRCm39) E153V probably benign Het
Crxos A G 7: 15,636,856 (GRCm39) E143G possibly damaging Het
Csmd2 A G 4: 128,439,920 (GRCm39) N3125D Het
Cyp2c67 T A 19: 39,605,876 (GRCm39) Q340L probably null Het
Dscam T A 16: 96,621,089 (GRCm39) N540Y possibly damaging Het
E2f8 G A 7: 48,525,508 (GRCm39) R155W probably damaging Het
Ext1 A T 15: 53,207,885 (GRCm39) V292D probably damaging Het
Extl3 T C 14: 65,314,090 (GRCm39) E364G possibly damaging Het
Fsd1 A T 17: 56,295,149 (GRCm39) D46V possibly damaging Het
Gcnt2 T A 13: 41,111,733 (GRCm39) L374H probably damaging Het
Gm10309 G A 17: 86,812,095 (GRCm39) probably benign Het
Gm14410 A T 2: 176,894,618 (GRCm39) probably null Het
Gm5114 A T 7: 39,057,404 (GRCm39) S738R probably benign Het
Gtf3c2 C A 5: 31,325,100 (GRCm39) G502W probably damaging Het
Insc G A 7: 114,368,058 (GRCm39) probably null Het
Kcnt2 T C 1: 140,498,216 (GRCm39) Y898H possibly damaging Het
Kctd19 C A 8: 106,118,664 (GRCm39) R299L probably benign Het
Klf10 T C 15: 38,297,446 (GRCm39) N198S probably benign Het
L3mbtl1 A T 2: 162,808,524 (GRCm39) D574V probably damaging Het
Lamc1 G A 1: 153,208,011 (GRCm39) A92V possibly damaging Het
Lrrc63 T A 14: 75,363,643 (GRCm39) T163S possibly damaging Het
Mak T A 13: 41,204,956 (GRCm39) K127N probably damaging Het
Mdga2 G A 12: 66,533,535 (GRCm39) Q945* probably null Het
Mthfr T A 4: 148,137,059 (GRCm39) I519N possibly damaging Het
Mtmr2 C A 9: 13,710,521 (GRCm39) H357N probably damaging Het
Myh13 A T 11: 67,217,990 (GRCm39) E21V possibly damaging Het
Myh13 A C 11: 67,258,537 (GRCm39) Q184P Het
Nans T A 4: 46,502,484 (GRCm39) L307Q probably damaging Het
Ncan C A 8: 70,554,691 (GRCm39) R1042L possibly damaging Het
Nrg3 T C 14: 38,733,956 (GRCm39) E310G probably damaging Het
Obsl1 A C 1: 75,474,828 (GRCm39) N857K probably benign Het
Olfml2a T C 2: 38,850,273 (GRCm39) V663A probably damaging Het
Or14j10 T C 17: 37,935,277 (GRCm39) D83G probably benign Het
Or51v15-ps1 C A 7: 103,278,354 (GRCm39) W271L unknown Het
Or52e19b A G 7: 103,032,969 (GRCm39) I80T probably damaging Het
Or6d13 G T 6: 116,517,999 (GRCm39) C195F probably damaging Het
Or8i2 T C 2: 86,852,898 (GRCm39) probably benign Het
Pla2g4a T C 1: 149,740,951 (GRCm39) M363V possibly damaging Het
Pramel26 T C 4: 143,538,269 (GRCm39) D234G probably benign Het
Prickle1 A T 15: 93,406,552 (GRCm39) V157D possibly damaging Het
Pstk A G 7: 130,975,362 (GRCm39) N105S probably benign Het
Ptpn21 A G 12: 98,703,622 (GRCm39) probably null Het
Rnf2 T A 1: 151,347,467 (GRCm39) E277D probably benign Het
Rnpepl1 T C 1: 92,846,694 (GRCm39) F532S probably benign Het
Rtn1 C T 12: 72,355,164 (GRCm39) A261T possibly damaging Het
Ryr2 A G 13: 11,609,762 (GRCm39) S4355P probably benign Het
Sacs T G 14: 61,448,627 (GRCm39) L3558V probably benign Het
Senp6 T C 9: 80,049,610 (GRCm39) V1047A probably damaging Het
Slco2b1 A T 7: 99,314,039 (GRCm39) C515S probably damaging Het
Smgc T A 15: 91,744,892 (GRCm39) V732E possibly damaging Het
Sorcs1 T C 19: 50,141,550 (GRCm39) M1105V possibly damaging Het
Spats1 A G 17: 45,768,087 (GRCm39) Y160H possibly damaging Het
Tnfsf14 T A 17: 57,497,848 (GRCm39) D128V Het
Tns3 T C 11: 8,480,894 (GRCm39) Q234R probably damaging Het
Uxs1 A G 1: 43,796,184 (GRCm39) V306A possibly damaging Het
Vac14 T A 8: 111,363,066 (GRCm39) V304D probably damaging Het
Vangl1 A G 3: 102,091,565 (GRCm39) F174L probably benign Het
Vav1 A G 17: 57,606,102 (GRCm39) E242G probably benign Het
Vsir A G 10: 60,204,701 (GRCm39) N305D probably benign Het
Vwce T A 19: 10,624,305 (GRCm39) C399S possibly damaging Het
Wrn A T 8: 33,819,209 (GRCm39) L248M probably damaging Het
Zfp141 T A 7: 42,125,678 (GRCm39) K265* probably null Het
Zfp735 A T 11: 73,602,002 (GRCm39) K315N possibly damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174,330,885 (GRCm39) missense unknown
IGL01085:Fmn2 APN 1 174,523,220 (GRCm39) missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174,329,994 (GRCm39) missense unknown
IGL02095:Fmn2 APN 1 174,330,167 (GRCm39) missense unknown
IGL02330:Fmn2 APN 1 174,437,511 (GRCm39) missense probably benign 0.38
IGL02552:Fmn2 APN 1 174,523,286 (GRCm39) missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174,409,625 (GRCm39) missense unknown
PIT4498001:Fmn2 UTSW 1 174,440,170 (GRCm39) missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174,474,699 (GRCm39) missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174,618,880 (GRCm39) missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0306:Fmn2 UTSW 1 174,437,050 (GRCm39) unclassified probably benign
R0325:Fmn2 UTSW 1 174,437,520 (GRCm39) critical splice donor site probably null
R0403:Fmn2 UTSW 1 174,521,844 (GRCm39) missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174,409,525 (GRCm39) missense unknown
R0898:Fmn2 UTSW 1 174,331,026 (GRCm39) missense unknown
R1202:Fmn2 UTSW 1 174,440,101 (GRCm39) nonsense probably null
R1719:Fmn2 UTSW 1 174,436,024 (GRCm39) unclassified probably benign
R1763:Fmn2 UTSW 1 174,329,832 (GRCm39) missense unknown
R1771:Fmn2 UTSW 1 174,436,342 (GRCm39) unclassified probably benign
R1777:Fmn2 UTSW 1 174,409,488 (GRCm39) missense unknown
R1831:Fmn2 UTSW 1 174,437,511 (GRCm39) missense probably benign 0.38
R2259:Fmn2 UTSW 1 174,330,498 (GRCm39) missense unknown
R2960:Fmn2 UTSW 1 174,437,385 (GRCm39) missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174,330,192 (GRCm39) missense unknown
R3840:Fmn2 UTSW 1 174,409,599 (GRCm39) frame shift probably null
R4207:Fmn2 UTSW 1 174,409,521 (GRCm39) missense unknown
R4679:Fmn2 UTSW 1 174,330,728 (GRCm39) missense unknown
R4779:Fmn2 UTSW 1 174,437,461 (GRCm39) missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174,409,527 (GRCm39) missense unknown
R4926:Fmn2 UTSW 1 174,329,981 (GRCm39) missense unknown
R5007:Fmn2 UTSW 1 174,571,866 (GRCm39) missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174,648,794 (GRCm39) missense probably benign 0.04
R5324:Fmn2 UTSW 1 174,436,446 (GRCm39) unclassified probably benign
R5353:Fmn2 UTSW 1 174,330,572 (GRCm39) missense unknown
R5420:Fmn2 UTSW 1 174,526,344 (GRCm39) nonsense probably null
R5607:Fmn2 UTSW 1 174,437,377 (GRCm39) missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174,409,603 (GRCm39) missense unknown
R5982:Fmn2 UTSW 1 174,330,019 (GRCm39) missense unknown
R6148:Fmn2 UTSW 1 174,494,229 (GRCm39) missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174,440,119 (GRCm39) missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174,437,149 (GRCm39) unclassified probably benign
R6647:Fmn2 UTSW 1 174,420,670 (GRCm39) missense unknown
R6835:Fmn2 UTSW 1 174,527,235 (GRCm39) missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7340:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7378:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7457:Fmn2 UTSW 1 174,331,303 (GRCm39) splice site probably null
R7564:Fmn2 UTSW 1 174,437,140 (GRCm39) missense unknown
R7582:Fmn2 UTSW 1 174,526,356 (GRCm39) missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174,494,215 (GRCm39) missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8035:Fmn2 UTSW 1 174,547,437 (GRCm39) missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8343:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8371:Fmn2 UTSW 1 174,437,173 (GRCm39) missense unknown
R8377:Fmn2 UTSW 1 174,436,011 (GRCm39) nonsense probably null
R8543:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8724:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8726:Fmn2 UTSW 1 174,437,404 (GRCm39) missense possibly damaging 0.86
R8891:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R9074:Fmn2 UTSW 1 174,436,198 (GRCm39) missense unknown
R9167:Fmn2 UTSW 1 174,331,056 (GRCm39) missense unknown
R9489:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9598:Fmn2 UTSW 1 174,436,308 (GRCm39) missense unknown
R9605:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9698:Fmn2 UTSW 1 174,364,739 (GRCm39) missense unknown
RF010:Fmn2 UTSW 1 174,409,581 (GRCm39) missense unknown
Z1176:Fmn2 UTSW 1 174,435,960 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAGTCCTCCAGTTTCATGCCTG -3'
(R):5'- GTATTCCCACTCCAGGAAGAG -3'

Sequencing Primer
(F):5'- CAGTTTCATGCCTGGCCTGG -3'
(R):5'- GGTATTCCCACTCCAGGAAGAG -3'
Posted On 2019-10-07