Incidental Mutation 'R7474:Blvra'
ID579322
Institutional Source Beutler Lab
Gene Symbol Blvra
Ensembl Gene ENSMUSG00000001999
Gene Namebiliverdin reductase A
Synonyms0610006A11Rik, Blvr, 2500001N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127070665-127097084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127086849 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 86 (F86L)
Ref Sequence ENSEMBL: ENSMUSP00000002064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002064] [ENSMUST00000110389] [ENSMUST00000135529] [ENSMUST00000142737]
Predicted Effect probably damaging
Transcript: ENSMUST00000002064
AA Change: F86L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999
AA Change: F86L

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 2.1e-22 PFAM
Pfam:Biliv-reduc_cat 132 244 2.6e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110389
AA Change: F86L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106019
Gene: ENSMUSG00000001999
AA Change: F86L

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 9.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135529
AA Change: F86L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118278
Gene: ENSMUSG00000001999
AA Change: F86L

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 1e-22 PFAM
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142737
AA Change: F86L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116825
Gene: ENSMUSG00000001999
AA Change: F86L

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 4.7e-24 PFAM
Pfam:NAD_binding_3 15 122 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: This locus controls electrophoretic mobility of biliverdin reductase. The a allele determines a slowly migrating band in C3H/He, C57BL/H and 101/H; the b allele determines a fast band in BALB/c, CBA/Ca, TFH/H and SM/J. Heterozygotes have both parental bands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
L3mbtl1 A T 2: 162,966,604 D574V probably damaging Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in Blvra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Blvra APN 2 127082951 missense probably damaging 1.00
R1084:Blvra UTSW 2 127080653 missense probably benign 0.00
R1932:Blvra UTSW 2 127095148 missense probably damaging 1.00
R2114:Blvra UTSW 2 127086069 nonsense probably null
R2115:Blvra UTSW 2 127086069 nonsense probably null
R2117:Blvra UTSW 2 127086069 nonsense probably null
R2122:Blvra UTSW 2 127086897 missense probably damaging 0.96
R3734:Blvra UTSW 2 127090255 intron probably benign
R3847:Blvra UTSW 2 127095191 missense probably damaging 0.96
R4110:Blvra UTSW 2 127095155 missense probably damaging 1.00
R4533:Blvra UTSW 2 127090384 splice site probably null
R4620:Blvra UTSW 2 127096965 missense probably damaging 1.00
R4702:Blvra UTSW 2 127092062 missense probably benign 0.01
R5921:Blvra UTSW 2 127087363 intron probably benign
R6322:Blvra UTSW 2 127080539 start gained probably benign
R7486:Blvra UTSW 2 127087323 missense unknown
R8188:Blvra UTSW 2 127095127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTTACAACTGGACATGTTTGG -3'
(R):5'- GCAAAGCCGATGCACATAAG -3'

Sequencing Primer
(F):5'- GATCATTCTTTACTTTGCAAGGGC -3'
(R):5'- TGCACATAAGGCAGCTTGCTG -3'
Posted On2019-10-07