Incidental Mutation 'R7474:L3mbtl1'
ID 579323
Institutional Source Beutler Lab
Gene Symbol L3mbtl1
Ensembl Gene ENSMUSG00000035576
Gene Name L3MBTL1 histone methyl-lysine binding protein
Synonyms L3MBTL1
MMRRC Submission 045548-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7474 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 162785392-162816442 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 162808524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 574 (D574V)
Ref Sequence ENSEMBL: ENSMUSP00000044038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035751]
AlphaFold A2A5N8
Predicted Effect probably damaging
Transcript: ENSMUST00000035751
AA Change: D574V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: D574V

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
MBT 280 380 5.34e-53 SMART
MBT 388 487 2.17e-53 SMART
MBT 496 591 1.49e-51 SMART
Pfam:zf-C2HC 627 655 1.7e-17 PFAM
SAM 754 821 3.49e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,278,088 (GRCm39) C3089* probably null Het
Abcc1 A G 16: 14,290,850 (GRCm39) T1487A possibly damaging Het
Agfg1 T A 1: 82,860,132 (GRCm39) L333* probably null Het
Agfg2 C A 5: 137,652,130 (GRCm39) V410F possibly damaging Het
Amotl2 T C 9: 102,607,310 (GRCm39) V706A probably benign Het
Apob A T 12: 8,059,185 (GRCm39) T2556S probably benign Het
Asb18 T A 1: 89,920,755 (GRCm39) H174L possibly damaging Het
Atp10a G A 7: 58,308,275 (GRCm39) E25K unknown Het
Aup1 T C 6: 83,031,948 (GRCm39) L65P probably benign Het
Blvra T C 2: 126,928,769 (GRCm39) F86L probably damaging Het
Cabp4 T C 19: 4,189,398 (GRCm39) D53G probably benign Het
Cd300c2 T A 11: 114,889,122 (GRCm39) E153V probably benign Het
Crxos A G 7: 15,636,856 (GRCm39) E143G possibly damaging Het
Csmd2 A G 4: 128,439,920 (GRCm39) N3125D Het
Cyp2c67 T A 19: 39,605,876 (GRCm39) Q340L probably null Het
Dscam T A 16: 96,621,089 (GRCm39) N540Y possibly damaging Het
E2f8 G A 7: 48,525,508 (GRCm39) R155W probably damaging Het
Ext1 A T 15: 53,207,885 (GRCm39) V292D probably damaging Het
Extl3 T C 14: 65,314,090 (GRCm39) E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Fsd1 A T 17: 56,295,149 (GRCm39) D46V possibly damaging Het
Gcnt2 T A 13: 41,111,733 (GRCm39) L374H probably damaging Het
Gm10309 G A 17: 86,812,095 (GRCm39) probably benign Het
Gm14410 A T 2: 176,894,618 (GRCm39) probably null Het
Gm5114 A T 7: 39,057,404 (GRCm39) S738R probably benign Het
Gtf3c2 C A 5: 31,325,100 (GRCm39) G502W probably damaging Het
Insc G A 7: 114,368,058 (GRCm39) probably null Het
Kcnt2 T C 1: 140,498,216 (GRCm39) Y898H possibly damaging Het
Kctd19 C A 8: 106,118,664 (GRCm39) R299L probably benign Het
Klf10 T C 15: 38,297,446 (GRCm39) N198S probably benign Het
Lamc1 G A 1: 153,208,011 (GRCm39) A92V possibly damaging Het
Lrrc63 T A 14: 75,363,643 (GRCm39) T163S possibly damaging Het
Mak T A 13: 41,204,956 (GRCm39) K127N probably damaging Het
Mdga2 G A 12: 66,533,535 (GRCm39) Q945* probably null Het
Mthfr T A 4: 148,137,059 (GRCm39) I519N possibly damaging Het
Mtmr2 C A 9: 13,710,521 (GRCm39) H357N probably damaging Het
Myh13 A T 11: 67,217,990 (GRCm39) E21V possibly damaging Het
Myh13 A C 11: 67,258,537 (GRCm39) Q184P Het
Nans T A 4: 46,502,484 (GRCm39) L307Q probably damaging Het
Ncan C A 8: 70,554,691 (GRCm39) R1042L possibly damaging Het
Nrg3 T C 14: 38,733,956 (GRCm39) E310G probably damaging Het
Obsl1 A C 1: 75,474,828 (GRCm39) N857K probably benign Het
Olfml2a T C 2: 38,850,273 (GRCm39) V663A probably damaging Het
Or14j10 T C 17: 37,935,277 (GRCm39) D83G probably benign Het
Or51v15-ps1 C A 7: 103,278,354 (GRCm39) W271L unknown Het
Or52e19b A G 7: 103,032,969 (GRCm39) I80T probably damaging Het
Or6d13 G T 6: 116,517,999 (GRCm39) C195F probably damaging Het
Or8i2 T C 2: 86,852,898 (GRCm39) probably benign Het
Pla2g4a T C 1: 149,740,951 (GRCm39) M363V possibly damaging Het
Pramel26 T C 4: 143,538,269 (GRCm39) D234G probably benign Het
Prickle1 A T 15: 93,406,552 (GRCm39) V157D possibly damaging Het
Pstk A G 7: 130,975,362 (GRCm39) N105S probably benign Het
Ptpn21 A G 12: 98,703,622 (GRCm39) probably null Het
Rnf2 T A 1: 151,347,467 (GRCm39) E277D probably benign Het
Rnpepl1 T C 1: 92,846,694 (GRCm39) F532S probably benign Het
Rtn1 C T 12: 72,355,164 (GRCm39) A261T possibly damaging Het
Ryr2 A G 13: 11,609,762 (GRCm39) S4355P probably benign Het
Sacs T G 14: 61,448,627 (GRCm39) L3558V probably benign Het
Senp6 T C 9: 80,049,610 (GRCm39) V1047A probably damaging Het
Slco2b1 A T 7: 99,314,039 (GRCm39) C515S probably damaging Het
Smgc T A 15: 91,744,892 (GRCm39) V732E possibly damaging Het
Sorcs1 T C 19: 50,141,550 (GRCm39) M1105V possibly damaging Het
Spats1 A G 17: 45,768,087 (GRCm39) Y160H possibly damaging Het
Tnfsf14 T A 17: 57,497,848 (GRCm39) D128V Het
Tns3 T C 11: 8,480,894 (GRCm39) Q234R probably damaging Het
Uxs1 A G 1: 43,796,184 (GRCm39) V306A possibly damaging Het
Vac14 T A 8: 111,363,066 (GRCm39) V304D probably damaging Het
Vangl1 A G 3: 102,091,565 (GRCm39) F174L probably benign Het
Vav1 A G 17: 57,606,102 (GRCm39) E242G probably benign Het
Vsir A G 10: 60,204,701 (GRCm39) N305D probably benign Het
Vwce T A 19: 10,624,305 (GRCm39) C399S possibly damaging Het
Wrn A T 8: 33,819,209 (GRCm39) L248M probably damaging Het
Zfp141 T A 7: 42,125,678 (GRCm39) K265* probably null Het
Zfp735 A T 11: 73,602,002 (GRCm39) K315N possibly damaging Het
Other mutations in L3mbtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:L3mbtl1 APN 2 162,808,983 (GRCm39) missense probably damaging 1.00
IGL01090:L3mbtl1 APN 2 162,807,925 (GRCm39) missense probably damaging 1.00
IGL01291:L3mbtl1 APN 2 162,812,100 (GRCm39) missense probably benign 0.30
IGL02897:L3mbtl1 APN 2 162,807,692 (GRCm39) missense probably damaging 1.00
IGL02974:L3mbtl1 APN 2 162,812,103 (GRCm39) missense possibly damaging 0.68
IGL02986:L3mbtl1 APN 2 162,812,225 (GRCm39) missense probably damaging 1.00
IGL03057:L3mbtl1 APN 2 162,809,303 (GRCm39) missense probably damaging 1.00
IGL03372:L3mbtl1 APN 2 162,813,077 (GRCm39) splice site probably benign
ANU05:L3mbtl1 UTSW 2 162,812,100 (GRCm39) missense probably benign 0.30
R0006:L3mbtl1 UTSW 2 162,806,489 (GRCm39) missense possibly damaging 0.94
R0006:L3mbtl1 UTSW 2 162,806,489 (GRCm39) missense possibly damaging 0.94
R0067:L3mbtl1 UTSW 2 162,790,748 (GRCm39) missense probably damaging 1.00
R0067:L3mbtl1 UTSW 2 162,790,748 (GRCm39) missense probably damaging 1.00
R0078:L3mbtl1 UTSW 2 162,789,146 (GRCm39) missense probably benign 0.12
R0505:L3mbtl1 UTSW 2 162,789,255 (GRCm39) splice site probably benign
R0748:L3mbtl1 UTSW 2 162,813,084 (GRCm39) critical splice acceptor site probably null
R0748:L3mbtl1 UTSW 2 162,813,083 (GRCm39) splice site probably benign
R0761:L3mbtl1 UTSW 2 162,807,967 (GRCm39) missense probably damaging 1.00
R1789:L3mbtl1 UTSW 2 162,816,422 (GRCm39) missense probably benign
R1970:L3mbtl1 UTSW 2 162,801,492 (GRCm39) missense probably damaging 1.00
R2114:L3mbtl1 UTSW 2 162,801,990 (GRCm39) splice site probably null
R2115:L3mbtl1 UTSW 2 162,801,990 (GRCm39) splice site probably null
R2116:L3mbtl1 UTSW 2 162,801,990 (GRCm39) splice site probably null
R2117:L3mbtl1 UTSW 2 162,801,990 (GRCm39) splice site probably null
R2513:L3mbtl1 UTSW 2 162,809,505 (GRCm39) missense probably benign
R3848:L3mbtl1 UTSW 2 162,790,121 (GRCm39) missense probably damaging 1.00
R4877:L3mbtl1 UTSW 2 162,790,488 (GRCm39) missense probably damaging 0.98
R4930:L3mbtl1 UTSW 2 162,807,692 (GRCm39) missense probably damaging 1.00
R5930:L3mbtl1 UTSW 2 162,809,256 (GRCm39) small deletion probably benign
R5932:L3mbtl1 UTSW 2 162,809,256 (GRCm39) small deletion probably benign
R6562:L3mbtl1 UTSW 2 162,812,124 (GRCm39) missense probably benign 0.28
R6601:L3mbtl1 UTSW 2 162,790,095 (GRCm39) start gained probably benign
R6995:L3mbtl1 UTSW 2 162,803,368 (GRCm39) missense probably damaging 1.00
R7188:L3mbtl1 UTSW 2 162,791,460 (GRCm39) critical splice donor site probably null
R7346:L3mbtl1 UTSW 2 162,808,926 (GRCm39) missense probably benign 0.01
R7379:L3mbtl1 UTSW 2 162,802,899 (GRCm39) missense probably damaging 1.00
R7553:L3mbtl1 UTSW 2 162,790,151 (GRCm39) missense probably benign 0.01
R7599:L3mbtl1 UTSW 2 162,806,434 (GRCm39) missense possibly damaging 0.70
R8745:L3mbtl1 UTSW 2 162,812,137 (GRCm39) missense probably benign 0.08
R8910:L3mbtl1 UTSW 2 162,812,213 (GRCm39) missense probably benign 0.00
R9039:L3mbtl1 UTSW 2 162,807,988 (GRCm39) missense probably damaging 1.00
R9216:L3mbtl1 UTSW 2 162,806,972 (GRCm39) missense probably benign 0.04
R9253:L3mbtl1 UTSW 2 162,789,632 (GRCm39) missense probably benign 0.00
R9483:L3mbtl1 UTSW 2 162,790,734 (GRCm39) missense probably benign 0.01
R9509:L3mbtl1 UTSW 2 162,809,303 (GRCm39) missense probably damaging 1.00
R9683:L3mbtl1 UTSW 2 162,812,228 (GRCm39) missense possibly damaging 0.88
R9688:L3mbtl1 UTSW 2 162,790,697 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AACTCTGAGAAGCCATGGCC -3'
(R):5'- TAGTGTAGCATGAAGTCCTAAGG -3'

Sequencing Primer
(F):5'- CAGAGGCAGTCACTCTGTAG -3'
(R):5'- TGTAGCATGAAGTCCTAAGGAGTTAC -3'
Posted On 2019-10-07