Incidental Mutation 'R7474:L3mbtl1'
ID579323
Institutional Source Beutler Lab
Gene Symbol L3mbtl1
Ensembl Gene ENSMUSG00000035576
Gene NameL3MBTL1 histone methyl-lysine binding protein
SynonymsL3MBTL1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7474 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location162943472-162974522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162966604 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 574 (D574V)
Ref Sequence ENSEMBL: ENSMUSP00000044038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035751]
Predicted Effect probably damaging
Transcript: ENSMUST00000035751
AA Change: D574V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: D574V

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
MBT 280 380 5.34e-53 SMART
MBT 388 487 2.17e-53 SMART
MBT 496 591 1.49e-51 SMART
Pfam:zf-C2HC 627 655 1.7e-17 PFAM
SAM 754 821 3.49e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,328,088 C3089* probably null Het
Abcc1 A G 16: 14,472,986 T1487A possibly damaging Het
Agfg1 T A 1: 82,882,411 L333* probably null Het
Agfg2 C A 5: 137,653,868 V410F possibly damaging Het
Amotl2 T C 9: 102,730,111 V706A probably benign Het
Apob A T 12: 8,009,185 T2556S probably benign Het
Asb18 T A 1: 89,993,033 H174L possibly damaging Het
Atp10a G A 7: 58,658,527 E25K unknown Het
Aup1 T C 6: 83,054,967 L65P probably benign Het
Blvra T C 2: 127,086,849 F86L probably damaging Het
Cabp4 T C 19: 4,139,399 D53G probably benign Het
Cd300c2 T A 11: 114,998,296 E153V probably benign Het
Crxos A G 7: 15,902,931 E143G possibly damaging Het
Csmd2 A G 4: 128,546,127 N3125D Het
Cyp2c67 T A 19: 39,617,432 Q340L probably null Het
Dscam T A 16: 96,819,889 N540Y possibly damaging Het
E2f8 G A 7: 48,875,760 R155W probably damaging Het
Ext1 A T 15: 53,344,489 V292D probably damaging Het
Extl3 T C 14: 65,076,641 E364G possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fsd1 A T 17: 55,988,149 D46V possibly damaging Het
Gcnt2 T A 13: 40,958,257 L374H probably damaging Het
Gm10309 G A 17: 86,504,667 probably benign Het
Gm13084 T C 4: 143,811,699 D234G probably benign Het
Gm14410 A T 2: 177,202,825 probably null Het
Gm5114 A T 7: 39,407,980 S738R probably benign Het
Gtf3c2 C A 5: 31,167,756 G502W probably damaging Het
Insc G A 7: 114,768,823 probably null Het
Kcnt2 T C 1: 140,570,478 Y898H possibly damaging Het
Kctd19 C A 8: 105,392,032 R299L probably benign Het
Klf10 T C 15: 38,297,202 N198S probably benign Het
Lamc1 G A 1: 153,332,265 A92V possibly damaging Het
Lrrc63 T A 14: 75,126,203 T163S possibly damaging Het
Mak T A 13: 41,051,480 K127N probably damaging Het
Mdga2 G A 12: 66,486,761 Q945* probably null Het
Mthfr T A 4: 148,052,602 I519N possibly damaging Het
Mtmr2 C A 9: 13,799,225 H357N probably damaging Het
Myh13 A T 11: 67,327,164 E21V possibly damaging Het
Myh13 A C 11: 67,367,711 Q184P Het
Nans T A 4: 46,502,484 L307Q probably damaging Het
Ncan C A 8: 70,102,041 R1042L possibly damaging Het
Nrg3 T C 14: 39,011,999 E310G probably damaging Het
Obsl1 A C 1: 75,498,184 N857K probably benign Het
Olfml2a T C 2: 38,960,261 V663A probably damaging Het
Olfr1104 T C 2: 87,022,554 probably benign Het
Olfr116 T C 17: 37,624,386 D83G probably benign Het
Olfr213 G T 6: 116,541,038 C195F probably damaging Het
Olfr603 A G 7: 103,383,762 I80T probably damaging Het
Olfr621-ps1 C A 7: 103,629,147 W271L unknown Het
Pla2g4a T C 1: 149,865,200 M363V possibly damaging Het
Prickle1 A T 15: 93,508,671 V157D possibly damaging Het
Pstk A G 7: 131,373,633 N105S probably benign Het
Ptpn21 A G 12: 98,737,363 probably null Het
Rnf2 T A 1: 151,471,716 E277D probably benign Het
Rnpepl1 T C 1: 92,918,972 F532S probably benign Het
Rtn1 C T 12: 72,308,390 A261T possibly damaging Het
Ryr2 A G 13: 11,594,876 S4355P probably benign Het
Sacs T G 14: 61,211,178 L3558V probably benign Het
Senp6 T C 9: 80,142,328 V1047A probably damaging Het
Slco2b1 A T 7: 99,664,832 C515S probably damaging Het
Smgc T A 15: 91,860,694 V732E possibly damaging Het
Sorcs1 T C 19: 50,153,112 M1105V possibly damaging Het
Spats1 A G 17: 45,457,161 Y160H possibly damaging Het
Tnfsf14 T A 17: 57,190,848 D128V Het
Tns3 T C 11: 8,530,894 Q234R probably damaging Het
Uxs1 A G 1: 43,757,024 V306A possibly damaging Het
Vac14 T A 8: 110,636,434 V304D probably damaging Het
Vangl1 A G 3: 102,184,249 F174L probably benign Het
Vav1 A G 17: 57,299,102 E242G probably benign Het
Vsir A G 10: 60,368,922 N305D probably benign Het
Vwce T A 19: 10,646,941 C399S possibly damaging Het
Wrn A T 8: 33,329,181 L248M probably damaging Het
Zfp141 T A 7: 42,476,254 K265* probably null Het
Zfp735 A T 11: 73,711,176 K315N possibly damaging Het
Other mutations in L3mbtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:L3mbtl1 APN 2 162967063 missense probably damaging 1.00
IGL01090:L3mbtl1 APN 2 162966005 missense probably damaging 1.00
IGL01291:L3mbtl1 APN 2 162970180 missense probably benign 0.30
IGL02897:L3mbtl1 APN 2 162965772 missense probably damaging 1.00
IGL02974:L3mbtl1 APN 2 162970183 missense possibly damaging 0.68
IGL02986:L3mbtl1 APN 2 162970305 missense probably damaging 1.00
IGL03057:L3mbtl1 APN 2 162967383 missense probably damaging 1.00
IGL03372:L3mbtl1 APN 2 162971157 splice site probably benign
ANU05:L3mbtl1 UTSW 2 162970180 missense probably benign 0.30
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0078:L3mbtl1 UTSW 2 162947226 missense probably benign 0.12
R0505:L3mbtl1 UTSW 2 162947335 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971163 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971164 critical splice acceptor site probably null
R0761:L3mbtl1 UTSW 2 162966047 missense probably damaging 1.00
R1789:L3mbtl1 UTSW 2 162974502 missense probably benign
R1970:L3mbtl1 UTSW 2 162959572 missense probably damaging 1.00
R2114:L3mbtl1 UTSW 2 162960070 splice site probably null
R2115:L3mbtl1 UTSW 2 162960070 splice site probably null
R2116:L3mbtl1 UTSW 2 162960070 splice site probably null
R2117:L3mbtl1 UTSW 2 162960070 splice site probably null
R2513:L3mbtl1 UTSW 2 162967585 missense probably benign
R3848:L3mbtl1 UTSW 2 162948201 missense probably damaging 1.00
R4877:L3mbtl1 UTSW 2 162948568 missense probably damaging 0.98
R4930:L3mbtl1 UTSW 2 162965772 missense probably damaging 1.00
R5930:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R5932:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R6562:L3mbtl1 UTSW 2 162970204 missense probably benign 0.28
R6601:L3mbtl1 UTSW 2 162948175 start gained probably benign
R6995:L3mbtl1 UTSW 2 162961448 missense probably damaging 1.00
R7188:L3mbtl1 UTSW 2 162949540 critical splice donor site probably null
R7346:L3mbtl1 UTSW 2 162967006 missense probably benign 0.01
R7379:L3mbtl1 UTSW 2 162960979 missense probably damaging 1.00
R7553:L3mbtl1 UTSW 2 162948231 missense probably benign 0.01
R7599:L3mbtl1 UTSW 2 162964514 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AACTCTGAGAAGCCATGGCC -3'
(R):5'- TAGTGTAGCATGAAGTCCTAAGG -3'

Sequencing Primer
(F):5'- CAGAGGCAGTCACTCTGTAG -3'
(R):5'- TGTAGCATGAAGTCCTAAGGAGTTAC -3'
Posted On2019-10-07